TkA03G407540 | RubberDandelionOmics

Gene overview

TkA03G407540

Reference: TK1151 Chr: Chr03 Coordinates: 101313415-101316592 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1921 bp · TkA03G407540|TK1151|cDNA

CTACGCCATTAATCCAGCTCATAAGATACCCGCCGCTTACTCCTACTCTTTTGTTCCAATTTAATCCATACAAACCCATCAAAAATCACCAAAAACCATCATGCTATCTCCGAAGTCACTCTTATTTCTCCTGCTACCCATCTTACTTACGTTCTTACCTCATGGAGGTTCACATATTCTTCAATCTTCAGGGGTGATTAATAGCAGGTCTCATCGAGAAACTGAACGGGCTGTTCTTGAAAAGGGGATTAGTGATGATG...

CDS

Download CDS FASTA

1611 bp · TkA03G407540|TK1151|CDS

ATGCTATCTCCGAAGTCACTCTTATTTCTCCTGCTACCCATCTTACTTACGTTCTTACCTCATGGAGGTTCACATATTCTTCAATCTTCAGGGGTGATTAATAGCAGGTCTCATCGAGAAACTGAACGGGCTGTTCTTGAAAAGGGGATTAGTGATGATGGTAACTCGTCTCTGATATTGGCGGATGAGAGAACAAGAAGGAAAGACCCCAGCAACGATTTCAGATATTACACCGATGGATGGAATATCAGTGATGAACA...

Protein

Download Protein FASTA

536 aa · TkA03G407540|TK1151|PROTEIN

MLSPKSLLFLLLPILLTFLPHGGSHILQSSGVINSRSHRETERAVLEKGISDDGNSSLILADERTRRKDPSNDFRYYTDGWNISDEHYVSSVAFTAVPLFAIAVTWFVAFGLFLGITCCCYCCFPRRPYGYSRTAHKLSLVFLSLFTISTIVGCVVLYTGQGKFNESTTDTLDYVVSQSNDTIYKLKNVSAILSVAKGIEVDQVSLTSDIKTHIDRVHEMIDGAARNLQIETRKNEKDIKRVLEDVRLALIIIAAVMLLV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G407540`
TK1151 ID	TkA03G407540
OH-1004 ID	LXL04_009193
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.800
Protein coverage (%)	TK1151 100.000 / OH-1004 93.194 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G407540`
Location	Chr03:101313415-101316592 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_009193` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.601

Rank 1 · TkA03G407540 · TK1151

Lysosome / Vacuole0.208

Rank 2 · TkA03G407540 · TK1151

Cytoplasm0.126

Rank 3 · TkA03G407540 · TK1151

Endoplasmic reticulum0.094

Rank 4 · TkA03G407540 · TK1151

Golgi apparatus0.053

Rank 5 · TkA03G407540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04906Tweety74-330 aa

PF12420DUF367184-139 aa

PF00335Tetraspanin90-180 aa

PF00487FA_desaturase93-113 aa

PF20990DUF2207_C93-130 aa

PF07344Amastin94-156 aa

PF18967PycTM96-131 aa

PF07331TctB99-124 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G407540	`PF04906`	Tweety	74	330	0.0039	16.6
TkA03G407540	`PF12420`	DUF3671	84	139	0.25	11.5
TkA03G407540	`PF00335`	Tetraspanin	90	180	0.028	14.8
TkA03G407540	`PF00487`	FA_desaturase	93	113	0.038	14.4
TkA03G407540	`PF20990`	DUF2207_C	93	130	0.46	10.8
TkA03G407540	`PF07344`	Amastin	94	156	0.82	10.3
TkA03G407540	`PF18967`	PycTM	96	131	1.0	9.9
TkA03G407540	`PF07331`	TctB	99	124	0.0055	17.6
TkA03G407540	`PF05478`	Prominin	99	191	0.26	10.0
TkA03G407540	`PF20237`	DUF6594	100	157	4.2	7.9
TkA03G407540	`PF29008`	DDB_G0292058_C	130	361	1.4e-10	41.4
TkA03G407540	`PF12650`	DUF3784	132	132	0.014	16.3
TkA03G407540	`PF20990`	DUF2207_C	191	304	0.46	10.8
TkA03G407540	`PF20237`	DUF6594	202	292	4.2	7.9
TkA03G407540	`PF05478`	Prominin	205	272	0.26	10.0
TkA03G407540	`PF07331`	TctB	232	304	0.0055	17.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card