TkA03G400860 | RubberDandelionOmics

Gene overview

TkA03G400860

Reference: TK1151 Chr: Chr03 Coordinates: 99685022-99688603 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3283 bp · TkA03G400860|TK1151|cDNA

TTTGTTTTTGGTGACCTAGACCTGACAACGATGAAGGATTTCGTTTCCAATCTTGACTCCGTTATCAACATCATCATCCAGAAATCACTCTGTCGAACATTTGGAAAACGCCCACAAACACCGATTCCTTCAATAACACTTCAAAATGCTTTCACATGCCCAATCCATGACTTCGCCTCTATCATCTATCTTCTCCCCCAAACTTCCAATTTATCCTTCCAAATTCAAACCTCACTTCAATCCACCCAAATCCCTTCTTC...

CDS

Download CDS FASTA

966 bp · TkA03G400860|TK1151|CDS

ATGCTTTCACATGCCCAATCCATGACTTCGCCTCTATCATCTATCTTCTCCCCCAAACTTCCAATTTATCCTTCCAAATTCAAACCTCACTTCAATCCACCCAAATCCCTTCTTCTTCAGCCTTTGAGATGTTCCGTTTCTTTGGCCCCCGAACCAACTCAATTACAATCGAATACCACCACCAACAGTTATAAACCCTCTCCACCTGAAATCTCACGAACAATCATGGAGTTATCCTCTGTTGGCACTTTTTCTACTAC...

Protein

Download Protein FASTA

321 aa · TkA03G400860|TK1151|PROTEIN

MLSHAQSMTSPLSSIFSPKLPIYPSKFKPHFNPPKSLLLQPLRCSVSLAPEPTQLQSNTTTNSYKPSPPEISRTIMELSSVGTFSTTAQDTWPLGVGVRFAVDPEGTPVICLSASHHHFATEIRSSLNVQLEQCGLRTTQCTIQGILHRPEDQILLKKIQSLWEKKFGEKADNDFIHILDVERVLQMDNFMEDGIWVVSSDYKLANPDPLRDCAEHLVHEINSNNIEDVHRFCNVFVDSDVQVSQAKMVWVDRLGFDIHL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G400860`
TK1151 ID	TkA03G400860
OH-1004 ID	LXL04_009131
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G400860

Location Chr03:99685022-99688603 (+)

Description Similar to GLUTRBP: Glutamyl-tRNA reductase-binding protein, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g21200`	Involved in the regulation of glutamyl-tRNA reductase (GluTR) which is important for the synthesis and distribution of 5-aminolevulinate, a precursor in heme and chlorophyll biosynthesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009131 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006783 heme biosynthetic process Biological Process

GO:0009767 photosynthetic electron transport chain Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0015995 chlorophyll biosynthetic process Biological Process

GO:0033014 tetrapyrrole biosynthetic process Biological Process

GO:0070455 positive regulation of heme biosynthetic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0032991 protein-containing complex Cellular Component

GO:0043495 protein-membrane adaptor activity Molecular Function

KEGG gene cross-reference

ath:AT3G21200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.907

Rank 1 · TkA03G400860 · TK1151

Nucleus0.076

Rank 2 · TkA03G400860 · TK1151

Mitochondrion0.073

Rank 3 · TkA03G400860 · TK1151

Cytoplasm0.061

Rank 4 · TkA03G400860 · TK1151

Peroxisome0.020

Rank 5 · TkA03G400860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17323ToxS189-232 aa

PF10615DUF2470216-287 aa

PF17323ToxS280-316 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G400860	`PF17323`	ToxS	189	232	0.079	13.5
TkA03G400860	`PF10615`	DUF2470	216	287	9e-10	39.7
TkA03G400860	`PF17323`	ToxS	280	316	0.079	13.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LU39`	Arabidopsis thaliana	sp\|Q9LU39\|GLUBP_ARATH Glutamyl-tRNA reductase-binding protein, chloroplastic	60.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card