TkA03G386550 | RubberDandelionOmics

Gene overview

TkA03G386550

Reference: TK1151 Chr: Chr03 Coordinates: 95653664-95658354 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2757 bp · TkA03G386550|TK1151|cDNA

ATAAGTTGTCGCTTTCGATGGTAAATGAAAGGAACATTTAATTAGCAAATTCCGCCATTTTCGAGATATAGCTTTTTCTGAAATCGAAGTTGTCAGTGTTGAAGATTTTTAAAGCAAAACCAGGGTAAAAGCCAAGTTTCTCCACTAATCACATACAGTCGAACATCTGCAGATTATCGTACAGACACGTTGGCTCTTGAAGAAACTGAATCGAGTGTCATGTATTTGGTGAGTAGAATACATCATAAAACCCCCATCAG...

CDS

Download CDS FASTA

1422 bp · TkA03G386550|TK1151|CDS

ATGAGTAAAGAAAGGTGCATGGAAAAACACGAGGACTCAAAAATCGTTGAAACAGTCGTAGTTGCCGTTAAAGCATCAAGGGAAATTCCAAAGTCAGCTTTGGTTTGGGCTTTGACTCATGTAGTTCAACCAGGGCATTGCATTACACTACTTGTTGTCATCCCTTCTGGTAAAAGACTATGGGGTCTTCCGAGATTTACTGGAGATTGTGCTAGTCGTCATTGGAGATCTTATCTAGGAAAAAGTGATATCGCGGATTC...

Protein

Download Protein FASTA

473 aa · TkA03G386550|TK1151|PROTEIN

MSKERCMEKHEDSKIVETVVVAVKASREIPKSALVWALTHVVQPGHCITLLVVIPSGKRLWGLPRFTGDCASRHWRSYLGKSDIADSCSQMILQLHNMYDPNKINVKIKTVSGLPYGAVALEAKQIHATWVILDKKLKHEQKRCMEELQCNIVTIKKSRPKIIRLNLIGSPKNEPQITNQSSKKLQKDTKYSPQFSPEALSLTEPSTSISSSDPGASPFFIPLKSNHELAESSSDSESENLSSSFSRRFQPWMIDILTST...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G386550`
TK1151 ID	TkA03G386550
OH-1004 ID	LXL04_008306
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 96.617 / OH-1004 69.771 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G386550

Location Chr03:95653664-95658354 (+)

Description Similar to SELMODRAFT_444075: Inactive protein kinase SELMODRAFT_444075

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g24550`	Proline-rich receptor-like protein kinase PERK1.	No verified direct reference in this release
`At4g34440`	Proline-rich receptor-like protein kinase PERK5.	No verified direct reference in this release
`At1g26150`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release
`At1g70460`	Negatively regulates root hair elongation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008306 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0007165 signal transduction Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0032502 developmental process Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0019901 protein kinase binding Molecular Function

KEGG gene cross-reference

ath:AT1G23540

ath:AT1G26150

ath:AT1G70460

ath:AT5G38560

smo:SELMODRAFT_444075

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.467

Rank 1 · TkA03G386550 · TK1151

Cytoplasm0.350

Rank 2 · TkA03G386550 · TK1151

Nucleus0.329

Rank 3 · TkA03G386550 · TK1151

Endoplasmic reticulum0.051

Rank 4 · TkA03G386550 · TK1151

Plastid0.036

Rank 5 · TkA03G386550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase123-165 aa

PF00069Pkinase327-457 aa

PF07714PK_Tyr_Ser-Thr328-457 aa

PF03109ABC1332-354 aa

PF03109ABC1430-458 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G386550	`PF00069`	Pkinase	123	165	7.6e-22	78.7
TkA03G386550	`PF00069`	Pkinase	327	457	7.6e-22	78.7
TkA03G386550	`PF07714`	PK_Tyr_Ser-Thr	328	457	3.3e-23	83.0
TkA03G386550	`PF03109`	ABC1	332	354	0.028	14.3
TkA03G386550	`PF03109`	ABC1	430	458	0.028	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LV48`	Arabidopsis thaliana	sp\|Q9LV48\|PERK1_ARATH Proline-rich receptor-like protein kinase PERK1	52.100%	Swiss-Prot	Low
`Q8GX23`	Arabidopsis thaliana	sp\|Q8GX23\|PERK5_ARATH Proline-rich receptor-like protein kinase PERK5	47.800%	Swiss-Prot	Low
`Q9C660`	Arabidopsis thaliana	sp\|Q9C660\|PEK10_ARATH Proline-rich receptor-like protein kinase PERK10	53.300%	Swiss-Prot	Low
`Q9CAL8`	Arabidopsis thaliana	sp\|Q9CAL8\|PEK13_ARATH Proline-rich receptor-like protein kinase PERK13	52.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card