TkA03G382460 | RubberDandelionOmics

Gene overview

TkA03G382460

Reference: TK1151 Chr: Chr03 Coordinates: 94395959-94397034 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

828 bp · TkA03G382460|TK1151|cDNA

ATGCCGGAGCCCCACAATCCCAATACCAACATCATAACCGACGACGACATACTTCTTTGCAATATTCTGCCAAGGCTTCCGGCGAAGTCCGTCGGCCGTTTTATGTGTGTTTCCCGGCAATGGCACTCTTTAACTCCATGGCGCCGTTTGCCATTCGAAGTCGGATATTCCACGTGGATATCCATCGTCGCATCTTTACATGGATTGGTATGCGTTCAAAGAGGTCGGTCCAATGAAGCTAGATATTACGACCTAATTTT...

CDS

Download CDS FASTA

828 bp · TkA03G382460|TK1151|CDS

ATGCCGGAGCCCCACAATCCCAATACCAACATCATAACCGACGACGACATACTTCTTTGCAATATTCTGCCAAGGCTTCCGGCGAAGTCCGTCGGCCGTTTTATGTGTGTTTCCCGGCAATGGCACTCTTTAACTCCATGGCGCCGTTTGCCATTCGAAGTCGGATATTCCACGTGGATATCCATCGTCGCATCTTTACATGGATTGGTATGCGTTCAAAGAGGTCGGTCCAATGAAGCTAGATATTACGACCTAATTTT...

Protein

Download Protein FASTA

275 aa · TkA03G382460|TK1151|PROTEIN

MPEPHNPNTNIITDDDILLCNILPRLPAKSVGRFMCVSRQWHSLTPWRRLPFEVGYSTWISIVASLHGLVCVQRGRSNEARYYDLILWNPLTSDYKKLSKPSSDQQSYNHIKEGRFGLYYSTFEDDYKLICVTLHPNVYIYSLKTDSWRKVELESTTAMAVHYDQKFVKPSVLVDEKLYLLKEKTVNYREDPLYSITMFDIKTKNLREIATPTFVKQVERKEFMGLIVLRGCVHLCVAFTGHDESYTIELWRMDEDGDGD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G382460`
TK1151 ID	TkA03G382460
OH-1004 ID	LXL04_005060
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	83.900
Protein coverage (%)	TK1151 100.000 / OH-1004 80.149 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G382460

Location Chr03:94395959-94397034 (+)

Description Similar to At3g06240: F-box/kelch-repeat protein At3g06240

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g62060`	Putative F-box protein At5g62060.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005060 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009626 plant-type hypersensitive response Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:0042177 negative regulation of protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G47340

ath:AT1G53370

ath:AT3G06240

ath:AT4G12560

ath:AT5G18160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.601

Rank 1 · TkA03G382460 · TK1151

Nucleus0.354

Rank 2 · TkA03G382460 · TK1151

Cell membrane0.126

Rank 3 · TkA03G382460 · TK1151

Endoplasmic reticulum0.083

Rank 4 · TkA03G382460 · TK1151

Lysosome / Vacuole0.053

Rank 5 · TkA03G382460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box18-48 aa

PF12937F-box-like18-50 aa

PF01344Kelch_136-46 aa

PF08268FBA_359-268 aa

PF07734FBA_168-266 aa

PF01344Kelch_1137-151 aa

PF25262DUF7862151-203 aa

PF01344Kelch_1172-179 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G382460	`PF00646`	F-box	18	48	4.1e-05	24.0
TkA03G382460	`PF12937`	F-box-like	18	50	0.00011	22.6
TkA03G382460	`PF01344`	Kelch_1	36	46	0.098	12.9
TkA03G382460	`PF08268`	FBA_3	59	268	2.4e-14	53.8
TkA03G382460	`PF07734`	FBA_1	68	266	1e-14	55.0
TkA03G382460	`PF01344`	Kelch_1	137	151	0.098	12.9
TkA03G382460	`PF25262`	DUF7862	151	203	0.14	12.9
TkA03G382460	`PF01344`	Kelch_1	172	179	0.098	12.9
TkA03G382460	`PF01344`	Kelch_1	191	204	0.098	12.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FIT3`	Arabidopsis thaliana	sp\|Q9FIT3\|FB297_ARATH Putative F-box protein At5g62060	21.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card