TkA03G367760 | RubberDandelionOmics

Gene overview

TkA03G367760

Reference: TK1151 Chr: Chr03 Coordinates: 90702993-90706510 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3112 bp · TkA03G367760|TK1151|cDNA

GGAATGGGCCTTTGTCAGCCCAAGTTCATTAACCGCATTAAGATTAGAGGTAGTCGTCACCGGCAAATCGCGCGGGAAAATGTTCGTAGCATCTCCAGTGGAGGAGAACGGCGAAATGGAAGAAACGAGGCAGAAGTTTAGTGCTTTTCCGTTCACACCCTACTCGATTCAGATTGATTTTATGAATGCCCTCTATGATTCTCTTGACAAAGGAGGAATCGCAATGCTCGAAAGCCCTACTGGGACAGGAAAAACCCTAA...

CDS

Download CDS FASTA

2679 bp · TkA03G367760|TK1151|CDS

ATGTTCGTAGCATCTCCAGTGGAGGAGAACGGCGAAATGGAAGAAACGAGGCAGAAGTTTAGTGCTTTTCCGTTCACACCCTACTCGATTCAGATTGATTTTATGAATGCCCTCTATGATTCTCTTGACAAAGGAGGAATCGCAATGCTCGAAAGCCCTACTGGGACAGGAAAAACCCTAAGTATAATCTGCAGCGCTCTGCAATGGCTTGTTGATCGAAAGCAACGCAAAAATAATGATAATACAGTAGATACGCATCA...

Protein

Download Protein FASTA

892 aa · TkA03G367760|TK1151|PROTEIN

MFVASPVEENGEMEETRQKFSAFPFTPYSIQIDFMNALYDSLDKGGIAMLESPTGTGKTLSIICSALQWLVDRKQRKNNDNTVDTHQNGTTGDDDEPDWLRNIKTDSPKKKVKLKKRHGFRSKKRDKTGLEESFNDLFNHFREIEADYNVYGSVHSNPTVKGAGEMPDDKEFLVEEYESEDEKNGLSKRKSGGNCGVSSSSEGEEEGNESSDEDEEADFKIYFCSRTHSQLSQFVKELKKTSFANDLKVACLGSRKNFCI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G367760`
TK1151 ID	TkA03G367760
OH-1004 ID	LXL04_008481
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	96.500
Protein coverage (%)	TK1151 100.000 / OH-1004 76.373 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G367760`
Location	Chr03:90702993-90706510 (-)
Description	Similar to ddx11: ATP-dependent DNA helicase DDX11
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_008481` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006139 nucleobase-containing compound metabolic process Biological Process GO:0006260 DNA replication Biological Process GO:0006281 DNA repair Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006974 DNA damage response Biological Process GO:0007062 sister chromatid cohesion Biological Process GO:0007064 mitotic sister chromatid cohesion Biological Process GO:0009303 rRNA transcription Biological Process GO:0031297 replication fork processing Biological Process GO:0032091 negative regulation of protein binding Biological Process GO:0034085 establishment of sister chromatid cohesion Biological Process GO:0035563 positive regulation of chromatin binding Biological Process
KEGG gene cross-reference	dre:492353 hsa:1663 nfi:NFIA_071590 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.865

Rank 1 · TkA03G367760 · TK1151

Cytoplasm0.197

Rank 2 · TkA03G367760 · TK1151

Mitochondrion0.037

Rank 3 · TkA03G367760 · TK1151

Cell membrane0.020

Rank 4 · TkA03G367760 · TK1151

Golgi apparatus0.012

Rank 5 · TkA03G367760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04851ResIII26-63 aa

PF00270DEAD30-76 aa

PF13086AAA_1136-75 aa

PF02562PhoH38-75 aa

PF25199nSTAND_NTPase539-103 aa

PF13401AAA_2245-62 aa

PF04075F420H2_quin_red91-153 aa

PF00468Ribosomal_L34110-129 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G367760	`PF04851`	ResIII	26	63	6.6e-06	26.9
TkA03G367760	`PF00270`	DEAD	30	76	0.0001	22.8
TkA03G367760	`PF13086`	AAA_11	36	75	0.0053	17.3
TkA03G367760	`PF02562`	PhoH	38	75	0.00056	20.2
TkA03G367760	`PF25199`	nSTAND_NTPase5	39	103	0.23	12.0
TkA03G367760	`PF13401`	AAA_22	45	62	0.033	15.2
TkA03G367760	`PF04075`	F420H2_quin_red	91	153	0.14	13.0
TkA03G367760	`PF00468`	Ribosomal_L34	110	129	0.19	12.4
TkA03G367760	`PF13086`	AAA_11	215	389	0.0053	17.3
TkA03G367760	`PF06733`	DEAD_2	223	409	1.9e-53	181.4
TkA03G367760	`PF04851`	ResIII	355	395	6.6e-06	26.9
TkA03G367760	`PF00270`	DEAD	358	395	0.0001	22.8
TkA03G367760	`PF02562`	PhoH	376	399	0.00056	20.2
TkA03G367760	`PF13401`	AAA_22	378	402	0.033	15.2
TkA03G367760	`PF25199`	nSTAND_NTPase5	379	401	0.23	12.0
TkA03G367760	`PF04851`	ResIII	576	582	6.6e-06	26.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card