TkA03G360830 | RubberDandelionOmics

Gene overview

TkA03G360830

Reference: TK1151 Chr: Chr03 Coordinates: 89020191-89024483 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2312 bp · TkA03G360830|TK1151|cDNA

ATTCTTTTCTAATTTCTTTTCTTTTTTCTTAAATTCAACTTTTCAGGACAAAATCCAAGTTAGTTGCAAGATTTGCAACAATTCAATAAATTTCCAGCTCCTTTTTTAGCATAATTCCAATTTAGTTTCAGGGGTTTTTGCTTCTTTTACGTTAAACCTTCTTTGAAACGCACCTTATCTTCCCCACCTTTCCTTTCTCAGATGCCATTATAGATTTCATCTTCAAAGGTTCTTGAAATCAACACTCAAGAGAACATTTT...

CDS

Download CDS FASTA

1812 bp · TkA03G360830|TK1151|CDS

ATGGAAGCACTCATACAAACAAAAGGCCTTCTATCCCTCCCTTCAAACCCCAAATCCAAATCCTTCTTTCACCGACCACAACAGGGTCTCCGACAACGATTCAATCTTTCAAATTCTTTAAAACCCAAACCCCCAAATGGGTTTTCTCTAAATCTTGACACTTTTACAAAATTTACCGGTTTTGTGACGACCCCAGGTTTGATCAGTCCCCCAAAAGGCAGAACTTTTCATGTCTGCAAGGCTTCCACCGCCGCCCTCCC...

Protein

Download Protein FASTA

603 aa · TkA03G360830|TK1151|PROTEIN

MEALIQTKGLLSLPSNPKSKSFFHRPQQGLRQRFNLSNSLKPKPPNGFSLNLDTFTKFTGFVTTPGLISPPKGRTFHVCKASTAALPGGDEVESPKFMGVEILTLKKIVPLGLMFFCILFNYTILRDTKDVLVVTAQGSSAEIIPFLKTWVNLPMAIGFMLLYTKLSNVLSKKALFYTVILPFIAFFGAFGFVFYPLSGYFHPTALADRLLESLGPRFLGPLAILRIWSFCLFYVMAELWGSVVVSVLFWGFANQITTVD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G360830`
TK1151 ID	TkA03G360830
OH-1004 ID	LXL04_008541
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G360830

Location Chr03:89020191-89024483 (+)

Description Similar to Plastidic ATP/ADP-transporter

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80300`	May function as an ATP importer.	No verified direct reference in this release
`At1g15500`	ADP,ATP carrier protein 2, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008541 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0005471 ATP:ADP antiporter activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G15500

ath:AT1G80300

cmu:TC_0335

cpa:CP_0408

cpj:adt_1

cpn:CPn_0351

cpt:CpB0359

sot:102605062

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.975

Rank 1 · TkA03G360830 · TK1151

Mitochondrion0.029

Rank 2 · TkA03G360830 · TK1151

Cytoplasm0.020

Rank 3 · TkA03G360830 · TK1151

Nucleus0.019

Rank 4 · TkA03G360830 · TK1151

Peroxisome0.017

Rank 5 · TkA03G360830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03219TLC96-566 aa

PF11466Doppel155-169 aa

PF11466Doppel290-295 aa

PF28839F59B103_C300-344 aa

PF11466Doppel407-418 aa

PF28839F59B103_C422-436 aa

PF28839F59B103_C549-563 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G360830	`PF03219`	TLC	96	566	1.6e-200	667.8
TkA03G360830	`PF11466`	Doppel	155	169	0.075	13.4
TkA03G360830	`PF11466`	Doppel	290	295	0.075	13.4
TkA03G360830	`PF28839`	F59B103_C	300	344	0.021	15.1
TkA03G360830	`PF11466`	Doppel	407	418	0.075	13.4
TkA03G360830	`PF28839`	F59B103_C	422	436	0.021	15.1
TkA03G360830	`PF28839`	F59B103_C	549	563	0.021	15.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39002`	Arabidopsis thaliana	sp\|Q39002\|TLC1_ARATH ADP,ATP carrier protein 1, chloroplastic	78.700%	Swiss-Prot	High
`P92935`	Arabidopsis thaliana	sp\|P92935\|TLC2_ARATH ADP,ATP carrier protein 2, chloroplastic	77.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card