TkA03G358450 | RubberDandelionOmics

Gene overview

TkA03G358450

Reference: TK1151 Chr: Chr03 Coordinates: 88435051-88437495 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2019 bp · TkA03G358450|TK1151|cDNA

ATGTCGAAGACTCTTCTCTCCCGCATCACTCCCCGCCACAGCCGCAACTCAAAATCACCCTCCAACTTTCCAACTCATACCAAGAAAATCGTTCACCAAATCTGTGACATTCTCAGAACCCGAAGCACGCATTGGGAAGAAACACTCGAAACCCGCCTCTCTGAAGAAGGCATCGTTCCATCGGATGTTGCTCACCAAGTGTTTGACAAAATTCGAGACGTTGAATTGGGGTTGAAGTTCTTTGACTGGATTTCTCGGCG...

CDS

Download CDS FASTA

2019 bp · TkA03G358450|TK1151|CDS

ATGTCGAAGACTCTTCTCTCCCGCATCACTCCCCGCCACAGCCGCAACTCAAAATCACCCTCCAACTTTCCAACTCATACCAAGAAAATCGTTCACCAAATCTGTGACATTCTCAGAACCCGAAGCACGCATTGGGAAGAAACACTCGAAACCCGCCTCTCTGAAGAAGGCATCGTTCCATCGGATGTTGCTCACCAAGTGTTTGACAAAATTCGAGACGTTGAATTGGGGTTGAAGTTCTTTGACTGGATTTCTCGGCG...

Protein

Download Protein FASTA

672 aa · TkA03G358450|TK1151|PROTEIN

MSKTLLSRITPRHSRNSKSPSNFPTHTKKIVHQICDILRTRSTHWEETLETRLSEEGIVPSDVAHQVFDKIRDVELGLKFFDWISRRPYGCPLDGNSYSSLLKLLAKSKAFHEIDSVFILMKSEKESPTHDALNELIRVYSECGLIDKALEFYSFFIETYNCLPNVFSCNSLLTRLLKSDRLETAHQVYDEMLHRDNNTETGCCVDNYTTSIMVNALCKKGKVEEAKKKAFSLFKELKLKGFLPSVQTYGAMINGFCKEG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G358450`
TK1151 ID	TkA03G358450
OH-1004 ID	LXL04_005619
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	25.200
Protein coverage (%)	TK1151 34.524 / OH-1004 30.802 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G358450

Location Chr03:88435051-88437495 (+)

Description Similar to At4g20740: Pentatricopeptide repeat-containing protein At4g20740

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g52620`	Pentatricopeptide repeat-containing protein At1g52620.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005619 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010239 chloroplast mRNA processing Biological Process

GO:0009507 chloroplast Cellular Component

GO:0042644 chloroplast nucleoid Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G53700

ath:AT4G20740

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.803

Rank 1 · TkA03G358450 · TK1151

Plastid0.110

Rank 2 · TkA03G358450 · TK1151

Nucleus0.053

Rank 3 · TkA03G358450 · TK1151

Cytoplasm0.036

Rank 4 · TkA03G358450 · TK1151

Cell membrane0.012

Rank 5 · TkA03G358450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29070MSC6_N4-56 aa

PF13041PPR_272-107 aa

PF17177PPR_long72-194 aa

PF23276TPR_2491-154 aa

PF13812PPR_392-140 aa

PF13762MNE193-153 aa

PF29070MSC6_N96-228 aa

PF13041PPR_297-129 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G358450	`PF29070`	MSC6_N	4	56	1.9e-25	90.5
TkA03G358450	`PF13041`	PPR_2	72	107	2.9e-109	357.8
TkA03G358450	`PF17177`	PPR_long	72	194	1.6e-29	103.5
TkA03G358450	`PF23276`	TPR_24	91	154	6.3e-25	88.3
TkA03G358450	`PF13812`	PPR_3	92	140	2.5e-52	175.5
TkA03G358450	`PF13762`	MNE1	93	153	0.0025	18.5
TkA03G358450	`PF29070`	MSC6_N	96	228	1.9e-25	90.5
TkA03G358450	`PF13041`	PPR_2	97	129	2.9e-109	357.8
TkA03G358450	`PF01535`	PPR	97	124	3.5e-84	272.1
TkA03G358450	`PF25569`	TPR_ZFYVE26	98	130	0.018	16.0
TkA03G358450	`PF12921`	ATP13	121	162	5.2e-08	33.5
TkA03G358450	`PF14559`	TPR_19	126	152	6.2e-05	24.0
TkA03G358450	`PF00515`	TPR_1	131	153	0.099	13.2
TkA03G358450	`PF13428`	TPR_14	132	158	1.1e-06	29.4
TkA03G358450	`PF13041`	PPR_2	133	154	2.9e-109	357.8
TkA03G358450	`PF30078`	ATPase_expression_N	133	209	0.25	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SSR4`	Arabidopsis thaliana	sp\|Q9SSR4\|PPR77_ARATH Pentatricopeptide repeat-containing protein At1g52620	39.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card