TkA03G349150 | RubberDandelionOmics

Gene overview

TkA03G349150

Reference: TK1151 Chr: Chr03 Coordinates: 85920030-85921768 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1564 bp · TkA03G349150|TK1151|cDNA

TGGGCACAAGAAATTGACATTTCTTCAAACGGTGTTTAGATTCGCGAAAATAAACCCTCTATAACATGATTTTACTTAATTGCCCCTCTCAGGCATCTATTTATTCCCCTATACCTCTCCCTTAACATTCCACCCCACTCTTCAATTTCATCAACAAAGTCCTCTTTATATCGAAAGGTATAACCTTTTACTCATTTCCTTTTCAAATTTCACAATCTTTAAACCTTAAACATTTCATATTTCGTAAATTGTACACGAAA...

CDS

Download CDS FASTA

750 bp · TkA03G349150|TK1151|CDS

ATGGCTCAAATTGGGCTATTAGCTTTGGGTATTCTCTCAATGGTCTCTATGGTTCATGGAAACAACAATGGAGGTTGGATTGAAGCTCATGCAACCTTCTATGGAGGTGGCGATGCTTCTGGCACTATGGGTGGGGCTTGTGGGTATGGGAACTTATATAGTGAAGGCTATGGTACAAATACAGCAGCGCTAAGTACAGCTCTATTCAACAATGGAATGAGTTGTGGAGCTTGTTTCGAAATTAAATGTGCGGGTGAACG...

Protein

Download Protein FASTA

249 aa · TkA03G349150|TK1151|PROTEIN

MAQIGLLALGILSMVSMVHGNNNGGWIEAHATFYGGGDASGTMGGACGYGNLYSEGYGTNTAALSTALFNNGMSCGACFEIKCAGERKWCRPGSIVVTATNFCPPNNALPNDAGGWCNPPLHHFDLSQPIFQQIAQYKAGIVPVHYKRVPCVKKGGIRFTVNGHSYFNLVLITNVGGAGDVKAVAIKGSRTGWVPMSRNWGQNWQSNSNLDGQVLSFKVTTSDGHTVICNNAVPAGWSFGQTFTGGQFT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G349150`
TK1151 ID	TkA03G349150
OH-1004 ID	LXL04_008652
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 78.549 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G349150

Location Chr03:85920030-85921768 (-)

Description Similar to EXPA1: Expansin-A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g03090`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`At1g69530`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`At1g26770`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`At5g56320`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	LBD18 acts as a transcriptional activator that directly binds to the EXPANSIN14 promoter in promoting lateral root emergence of Arabidopsis.2013 · DOI: 10.1111/tpj.12013

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0823100`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008652 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006949 syncytium formation Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009828 plant-type cell wall loosening Biological Process

GO:0009831 plant-type cell wall modification involved in multidimensional cell growth Biological Process

GO:0010114 response to red light Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0010311 lateral root formation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G26770

ath:AT1G69530

ath:AT2G03090

ath:AT5G56320

dosa:Os01g0823100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.686

Rank 1 · TkA03G349150 · TK1151

Lysosome / Vacuole0.123

Rank 2 · TkA03G349150 · TK1151

Cytoplasm0.121

Rank 3 · TkA03G349150 · TK1151

Endoplasmic reticulum0.062

Rank 4 · TkA03G349150 · TK1151

Cell membrane0.039

Rank 5 · TkA03G349150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22514EXPB1_D130-152 aa

PF03330DPBB_131-42 aa

PF29515Expansin_N40-112 aa

PF03330DPBB_161-146 aa

PF01357Expansin_C157-234 aa

PF22514EXPB1_D1202-222 aa

PF29515Expansin_N217-228 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G349150	`PF22514`	EXPB1_D1	30	152	1.9e-07	32.2
TkA03G349150	`PF03330`	DPBB_1	31	42	5.2e-24	85.0
TkA03G349150	`PF29515`	Expansin_N	40	112	1.7e-10	41.9
TkA03G349150	`PF03330`	DPBB_1	61	146	5.2e-24	85.0
TkA03G349150	`PF01357`	Expansin_C	157	234	3.1e-32	111.2
TkA03G349150	`PF22514`	EXPB1_D1	202	222	1.9e-07	32.2
TkA03G349150	`PF29515`	Expansin_N	217	228	1.7e-10	41.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80622`	Arabidopsis thaliana	sp\|O80622\|EXP15_ARATH Expansin-A15	76.100%	Swiss-Prot	High
`Q9C554`	Arabidopsis thaliana	sp\|Q9C554\|EXPA1_ARATH Expansin-A1	80.400%	Swiss-Prot	High
`Q9LDR9`	Arabidopsis thaliana	sp\|Q9LDR9\|EXP10_ARATH Expansin-A10	75.400%	Swiss-Prot	High
`Q9FMA0`	Arabidopsis thaliana	sp\|Q9FMA0\|EXP14_ARATH Expansin-A14	73.600%	Swiss-Prot	High
`Q40636`	Oryza sativa subsp. japonica	sp\|Q40636\|EXPA2_ORYSJ Expansin-A2	75.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card