TkA03G345100 | RubberDandelionOmics

Gene overview

TkA03G345100

Reference: TK1151 Chr: Chr03 Coordinates: 84931898-84934388 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2052 bp · TkA03G345100|TK1151|cDNA

CTTGGCTTTGGCTGAACTCTTGCGACTCGGTGCCGAAGCCCCTTCAGGAACAGTGTTGTACACCCTAACCCCTCCCCCTTCTCCGTCAATACTCGGGTGTGGCATAACAAAGAGTCCAATGAATTAAGGATAGTTGTCATTATCCGCATGTGATGGTAGCTGTCATCACAGTATTTATAACAGGTAATATAACAAGAATCCGCAATCAATTTACGCCTGAAATTGTTTCCATAAATACGGTATATTTGAATATATTTGAA...

CDS

Download CDS FASTA

1626 bp · TkA03G345100|TK1151|CDS

ATGGTAGCTGTCATCACAGTATTTATAACAGGTAATATAACAAGAATCCGCAATCAATTTACGCCTGAAATTGTTTCCATAAATACGGTATATTTGAATATATTTGAAGAAACAAAATATTATAATGCTTGCAAGAATCTTTCTCTGCAAAACCCTCAAACCCCTAAAATGTTGAAAGAACAGCAAGGATCGTCATCTTCCGTCTTCCTGTTTCCAAACCCTAACCCTCTACTGCGCTCTTTCAACATTCCCGAACCCAT...

Protein

Download Protein FASTA

541 aa · TkA03G345100|TK1151|PROTEIN

MVAVITVFITGNITRIRNQFTPEIVSINTVYLNIFEETKYYNACKNLSLQNPQTPKMLKEQQGSSSSVFLFPNPNPLLRSFNIPEPIIRPPGIDPCSFLNPKPHADDKVKPMAPLDVDPCAEASRTDVIANTTHLTASEHAGGSFAEPPMAPMDFDSPAHSETSVPQIIYDVEEAKIESKNAQRIHCDVCDVICTSEGKLREHKEGKKHLKKFQKLPVSVSSSIIQETPPPVANAASIHKSENKKSDSLENAQSVESLHT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G345100`
TK1151 ID	TkA03G345100
OH-1004 ID	LXL04_008679
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.000
Protein coverage (%)	TK1151 98.152 / OH-1004 90.460 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G345100`
Location	Chr03:84931898-84934388 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_008679` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.737

Rank 1 · TkA03G345100 · TK1151

Cytoplasm0.255

Rank 2 · TkA03G345100 · TK1151

Cell membrane0.061

Rank 3 · TkA03G345100 · TK1151

Endoplasmic reticulum0.043

Rank 4 · TkA03G345100 · TK1151

Mitochondrion0.020

Rank 5 · TkA03G345100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12756zf-C2H2_2125-141 aa

PF13746Fer4_18169-199 aa

PF27047zf-C2H2_Trps1_3rd170-203 aa

PF23320Zn_SUZ12178-203 aa

PF12756zf-C2H2_2179-211 aa

PF29169Teflon_N181-195 aa

PF06220zf-U1185-212 aa

PF12874zf-met186-209 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G345100	`PF12756`	zf-C2H2_2	125	141	3.5e-05	24.7
TkA03G345100	`PF13746`	Fer4_18	169	199	0.34	11.8
TkA03G345100	`PF27047`	zf-C2H2_Trps1_3rd	170	203	0.12	13.7
TkA03G345100	`PF23320`	Zn_SUZ12	178	203	0.00024	21.5
TkA03G345100	`PF12756`	zf-C2H2_2	179	211	3.5e-05	24.7
TkA03G345100	`PF29169`	Teflon_N	181	195	0.028	15.3
TkA03G345100	`PF06220`	zf-U1	185	212	0.0091	16.5
TkA03G345100	`PF12874`	zf-met	186	209	3.4e-23	81.9
TkA03G345100	`PF00096`	zf-C2H2	186	204	0.0037	18.4
TkA03G345100	`PF13894`	zf-C2H2_4	186	205	0.76	11.4
TkA03G345100	`PF12171`	zf-C2H2_jaz	187	209	1.2e-10	41.9
TkA03G345100	`PF23217`	DUF7066	187	214	0.14	12.9
TkA03G345100	`PF23108`	Zf-C2H2_ZNF451	187	196	0.39	11.2
TkA03G345100	`PF23320`	Zn_SUZ12	268	288	0.00024	21.5
TkA03G345100	`PF27047`	zf-C2H2_Trps1_3rd	290	329	0.12	13.7
TkA03G345100	`PF23320`	Zn_SUZ12	301	329	0.00024	21.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card