TkA03G344340 | RubberDandelionOmics

Gene overview

TkA03G344340

Reference: TK1151 Chr: Chr03 Coordinates: 84695717-84697190 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1068 bp · TkA03G344340|TK1151|cDNA

ATGTTTGTAATGGGTGTGAATGAGAAGGAATACAAGTCTGACATCACCATTGTCTCTAATGCCAGCTGTACCACTAATTGTCTTGCTCATCTAGCCAAGGTTATTAATGACAAGTTTGGTATTGTTGAGGGACTTATGATTACTGTTCACTCCATCACAGCAACACAAAAGACTGTTGATGGTCCATCAATGAAGGACTGGAGAGGTGGAAGAGCTGCTTCTTTCAATATCATTCCTAGCAGTACTGGAGCTGCAAAGAA...

CDS

Download CDS FASTA

1068 bp · TkA03G344340|TK1151|CDS

ATGTTTGTAATGGGTGTGAATGAGAAGGAATACAAGTCTGACATCACCATTGTCTCTAATGCCAGCTGTACCACTAATTGTCTTGCTCATCTAGCCAAGGTTATTAATGACAAGTTTGGTATTGTTGAGGGACTTATGATTACTGTTCACTCCATCACAGCAACACAAAAGACTGTTGATGGTCCATCAATGAAGGACTGGAGAGGTGGAAGAGCTGCTTCTTTCAATATCATTCCTAGCAGTACTGGAGCTGCAAAGAA...

Protein

Download Protein FASTA

355 aa · TkA03G344340|TK1151|PROTEIN

MFVMGVNEKEYKSDITIVSNASCTTNCLAHLAKVINDKFGIVEGLMITVHSITATQKTVDGPSMKDWRGGRAASFNIIPSSTGAAKKWSLYLAFGHPHCERSNARHVRSGHSRLGFLGQYVLEMAEAEFFLQRYPRESPGPMRERVYALIAKRYLPKWVKAASLHNLIFQYDDMDKLLRIEREPPVKSVVWALFGAIYLCFGMPEVYGVLFEVFGMDPEDEECQPKLRRQLEDVDFVSAEFEGKNALGKKPPLLIRLPTN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G344340`
TK1151 ID	TkA03G344340
OH-1004 ID	LXL04_032445
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 85.096 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G344340

Location Chr03:84695717-84697190 (+)

Description Similar to RNC1: Ribonuclease III domain-containing protein RNC1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g37510`	Binds specific group II introns in chloroplasts and facilitates their splicing.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0810100`	Binds specific group II introns in chloroplasts and facilitates their splicing.	No verified direct reference in this release
`Os02g0601300`	Key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032445 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000373 Group II intron splicing Biological Process

GO:0006006 glucose metabolic process Biological Process

GO:0006096 glycolytic process Biological Process

GO:0006396 RNA processing Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

ath:AT4G37510

dosa:Os01g0810100

dosa:Os02g0601300

zma:100125654

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.456

Rank 1 · TkA03G344340 · TK1151

Cytoplasm0.381

Rank 2 · TkA03G344340 · TK1151

Mitochondrion0.105

Rank 3 · TkA03G344340 · TK1151

Cell membrane0.088

Rank 4 · TkA03G344340 · TK1151

Endoplasmic reticulum0.057

Rank 5 · TkA03G344340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00227Proteasome2-33 aa

PF02800Gp_dh_C22-87 aa

PF14622Ribonucleas_3_3109-205 aa

PF00636Ribonuclease_3113-200 aa

PF00227Proteasome119-178 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G344340	`PF00227`	Proteasome	2	33	0.22	11.8
TkA03G344340	`PF02800`	Gp_dh_C	22	87	8.7e-27	94.7
TkA03G344340	`PF14622`	Ribonucleas_3_3	109	205	8.1e-07	30.0
TkA03G344340	`PF00636`	Ribonuclease_3	113	200	1.3e-05	26.6
TkA03G344340	`PF00227`	Proteasome	119	178	0.22	11.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SZV0`	Arabidopsis thaliana	sp\|Q9SZV0\|RNC1_ARATH Ribonuclease III domain-containing protein RNC1, chloroplastic	67.200%	Swiss-Prot	High
`Q8S1Z0`	Oryza sativa subsp. japonica	sp\|Q8S1Z0\|RNC1_ORYSJ Ribonuclease III domain-containing protein RNC1, chloroplastic	69.700%	Swiss-Prot	High
`Q6K5G8`	Oryza sativa subsp. japonica	sp\|Q6K5G8\|G3PC3_ORYSJ Glyceraldehyde-3-phosphate dehydrogenase 3, cytosolic	91.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card