TkA03G344310 | RubberDandelionOmics

Gene overview

TkA03G344310

Reference: TK1151 Chr: Chr03 Coordinates: 84680435-84689006 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2432 bp · TkA03G344310|TK1151|cDNA

CTCAATTCCACATTTTGGCGTCAGCGGTACCAAAAGGCAGGCATGATTGGGGTCTGGGGATTGTGAATATCTTTCAAATTTTAAACCCAACTCGCTCACTTTTCACTCTGATCGCTAGCTTTCTGTTTCGTCGTCAATGGAGAACGGAATTGGAGCTGAAGTTTCATCATCGGTATCGGGAGAACTACGCCGTGTGGGGCTGGTCTATGATGAGCGGATGTGTAAGCATTCAACACCTACAGGCGAACCTCATCCCGAAA...

CDS

Download CDS FASTA

2070 bp · TkA03G344310|TK1151|CDS

GACTGGGGATTTGTATTTGAGCGGGGACGCCGTCACGGCTTCAGTAAATATCTTTCACATTTCAAAATCAACCCGCTCACTTTCTCTTCGCCGTCTGATCAATACCTTTCTGTTTCTTCGTCAATGGAGAATGAAATTGGAGCTCAATTTTCATCGTCGGTTTCGGGAGAAGTACGTCGTGTGGGGCTCGTCTACGATAAGCGGATGTGTAAGCATTCAACACCTACAGGCGAACCTCATCCCGAAAACCCCGATCGTAT...

Protein

Download Protein FASTA

689 aa · TkA03G344310|TK1151|PROTEIN

DWGFVFERGRRHGFSKYLSHFKINPLTFSSPSDQYLSVSSSMENEIGAQFSSSVSGEVRRVGLVYDKRMCKHSTPTGEPHPENPDRIRAIWSKLRIAKIPQRCVVFEAKEVEDQYIAAVHTSNHINLIKTISSENSASERNKVAEEYDSIYFNEGSSESAYLAAGSVLDVAAKVAKGELNSAFAIVRPPGHHAEENEPMGFCLFNNVAIATSFLLNQKELGIKKILIVDWDVHHGNGTQKTFWKDSQVLFFSVHRHEFGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G344310`
TK1151 ID	TkA03G344310
OH-1004 ID	LXL04_008699
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.400
Protein coverage (%)	TK1151 94.049 / OH-1004 39.951 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G344310

Location Chr03:84680435-84689006 (-)

Description Similar to HDA5: Histone deacetylase 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61060`	Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4) (Probable).	Regulation of flowering time by the histone deacetylase HDA5 in Arabidopsis.2015 · DOI: 10.1111/tpj.12868
`At5g61070`	Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4).	Histone acetylation affects expression of cellular patterning genes in the Arabidopsis root epidermis.2005 · DOI: 10.1073/pnas.0503143102 HDA18 affects cell fate in Arabidopsis root epidermis via histone acetylation at four kinase genes.2013 · DOI: 10.1105/tpc.112.107045
`At3g18520`	Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4).	PHYTOCHROME INTERACTING FACTOR3 associates with the histone deacetylase HDA15 in repression of chlorophyll biosynthesis and photosynthesis in etiolated Arabidopsis seedlings.2013 · DOI: 10.1105/tpc.113.109710 MYB96 recruits the HDA15 protein to suppress negative regulators of ABA signaling in Arabidopsis.2019 · DOI: 10.1038/s41467-019-09417-1 HY5 Interacts with the Histone Deacetylase HDA15 to Repress Hypocotyl Cell Elongation in Photomorphogenesis.2019 · DOI: 10.1104/pp.19.00055 Arabidopsis histone deacetylase HDA15 directly represses plant response to elevated ambient temperature.2019 · DOI: 10.1111/tpj.14492

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008699 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000209 protein polyubiquitination Biological Process

GO:0001932 regulation of protein phosphorylation Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006476 protein deacetylation Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006515 protein quality control for misfolded or incompletely synthesized proteins Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0007015 actin filament organization Biological Process

GO:0007026 negative regulation of microtubule depolymerization Biological Process

GO:0007173 epidermal growth factor receptor signaling pathway Biological Process

GO:0009908 flower development Biological Process

KEGG gene cross-reference

ath:AT5G61060

ath:AT5G61070

mmu:15185

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.522

Rank 1 · TkA03G344310 · TK1151

Nucleus0.379

Rank 2 · TkA03G344310 · TK1151

Cell membrane0.094

Rank 3 · TkA03G344310 · TK1151

Plastid0.086

Rank 4 · TkA03G344310 · TK1151

Mitochondrion0.078

Rank 5 · TkA03G344310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00850Hist_deacetyl80-379 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G344310	`PF00850`	Hist_deacetyl	80	379	4.3e-92	309.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RX28`	Arabidopsis thaliana	sp\|Q8RX28\|HDA5_ARATH Histone deacetylase 5	61.900%	Swiss-Prot	High
`Q8LRK8`	Arabidopsis thaliana	sp\|Q8LRK8\|HDA18_ARATH Histone deacetylase 18	66.300%	Swiss-Prot	Medium
`Q8GXJ1`	Arabidopsis thaliana	sp\|Q8GXJ1\|HDA15_ARATH Histone deacetylase 15	42.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card