TkA03G314860 | RubberDandelionOmics

Gene overview

TkA03G314860

Reference: TK1151 Chr: Chr03 Coordinates: 77346858-77348845 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1527 bp · TkA03G314860|TK1151|cDNA

TATAACAGAGGTTTACAGTCCCCTTATTTTCAGTTTAATTCATCTCTCCGTCGCCATCCTTCTTCTCTGAATCACATCATTCTCACCTAATGCGCCTTAGTTTCTTCCACATACTTAATTCAGAACCCTCGTCATGCTAATTTTGTGACCCAAGTCTTATCCTTTTTTCGAAAGTATGGTTCCTTCAAAAGATGCATCTCATATTGTAAACCAAGTCTTGGCCGCCATCATTCAAAACCATCCATTTCACGTTCATCTTG...

CDS

Download CDS FASTA

1326 bp · TkA03G314860|TK1151|CDS

ATGGTTCCTTCAAAAGATGCATCTCATATTGTAAACCAAGTCTTGGCCGCCATCATTCAAAACCATCCATTTCACGTTCATCTTGTCAACTCATCCTCTTTAACCCATCAGTTTTCAAATCCGCCATGGGCAAATCAGCTCGTCACCAACGTCCTCAGATCCATACCCAGATACTTCTTCCAATCCACAAGATCCATCGGGCGTCAAAACACCTCCAGACACCGAGCTCCTCTCAAACAAAGAAATCTTCATCAAGAATC...

Protein

Download Protein FASTA

441 aa · TkA03G314860|TK1151|PROTEIN

MVPSKDASHIVNQVLAAIIQNHPFHVHLVNSSSLTHQFSNPPWANQLVTNVLRSIPRYFFQSTRSIGRQNTSRHRAPLKQRNLHQESIKIRKDILLLGPAAYRDPQKVKLGLNKALEFYYWVESQFGFNHNEMTCREMAIVLARGNRLKDLWNFLKDMSRRTTGNLVTTTTMTCLIKVLGEEGLANEALAAFHRMKQFHCKPDVFSYNTTINALCKVNNFKMAKFLFEQMELPGFRCPPDTFTYTILISSYCKLSLQTSC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G314860`
TK1151 ID	TkA03G314860
OH-1004 ID	LXL04_008901
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G314860

Location Chr03:77346858-77348845 (+)

Description Similar to At1g77405: Pentatricopeptide repeat-containing protein At1g77405

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g77405`	Pentatricopeptide repeat-containing protein At1g77405.	No verified direct reference in this release
`At1g02420`	Putative pentatricopeptide repeat-containing protein At1g02420.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008901 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G77405

ath:AT3G22470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.689

Rank 1 · TkA03G314860 · TK1151

Plastid0.181

Rank 2 · TkA03G314860 · TK1151

Nucleus0.068

Rank 3 · TkA03G314860 · TK1151

Cytoplasm0.029

Rank 4 · TkA03G314860 · TK1151

Cell membrane0.011

Rank 5 · TkA03G314860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23276TPR_24127-194 aa

PF01535PPR142-160 aa

PF13041PPR_2143-172 aa

PF29070MSC6_N144-254 aa

PF17177PPR_long155-230 aa

PF13041PPR_2169-216 aa

PF01535PPR171-199 aa

PF13812PPR_3171-214 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G314860	`PF23276`	TPR_24	127	194	8.5e-09	36.1
TkA03G314860	`PF01535`	PPR	142	160	2.2e-35	119.1
TkA03G314860	`PF13041`	PPR_2	143	172	2.1e-59	198.1
TkA03G314860	`PF29070`	MSC6_N	144	254	1.5e-08	34.9
TkA03G314860	`PF17177`	PPR_long	155	230	3.1e-09	37.3
TkA03G314860	`PF13041`	PPR_2	169	216	2.1e-59	198.1
TkA03G314860	`PF01535`	PPR	171	199	2.2e-35	119.1
TkA03G314860	`PF13812`	PPR_3	171	214	9.2e-19	68.0
TkA03G314860	`PF12854`	PPR_1	173	196	4.4e-45	151.8
TkA03G314860	`PF23276`	TPR_24	180	241	8.5e-09	36.1
TkA03G314860	`PF12854`	PPR_1	199	231	4.4e-45	151.8
TkA03G314860	`PF13812`	PPR_3	201	251	9.2e-19	68.0
TkA03G314860	`PF13041`	PPR_2	202	253	2.1e-59	198.1
TkA03G314860	`PF01535`	PPR	205	231	2.2e-35	119.1
TkA03G314860	`PF12854`	PPR_1	237	253	4.4e-45	151.8
TkA03G314860	`PF01535`	PPR	242	254	2.2e-35	119.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q1PFC5`	Arabidopsis thaliana	sp\|Q1PFC5\|PP130_ARATH Pentatricopeptide repeat-containing protein At1g77405	62.100%	Swiss-Prot	High
`Q9FZ19`	Arabidopsis thaliana	sp\|Q9FZ19\|PPR5_ARATH Putative pentatricopeptide repeat-containing protein At1g02420	24.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card