RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G310280
Reference: TK1151 Chr: Chr03 Coordinates: 76262566-76266589 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3549 bp · TkA03G310280|TK1151|cDNA

AGCAAACGAAGCTTGATTCTGAAAAGAGAAAAGAGCCCACTTTTTATCTTCATTCTTCGGTCAACGAGTAACCAAAACAGAACCAGCAACTTTCTCTCCCTCCTTTCCCCTCTCTTCTTTCTCTCTCTCTCTCACATACACATACACATAGTAATCTGGCTGTGTTCCCAGCGTCTTGAGGTTTCCCCACATCCCCATTTATTGTTCTTAACCTTTGTTGTTGAGAATATGGTGCTTCCTTTAATGCTCCGCCATTAAAG...

CDS

Download CDS FASTA

2556 bp · TkA03G310280|TK1151|CDS

ATGGAGGCTATGGTCAAGGTATTATTTTATCTCTTTTTCATCTTGCTGTTGCTGGTTAACTCGGTGTTGACCCAGTCCACGGTGCGGCCACTGAGTTCCGGTGTAGAAAGAACGGCGCTGCTGGATCTTCGAGCTTCTTTAGGAATAAAAGCCAGATACTGGCCGAGGAAATTAGACCCGTGTGCCAACTGGACAGGGGTGGAGTGCGGGAACGGCCGAGTCACCGGAATAAATTTGTCCGGTTTACGACGAACTCGTGT...

Protein

Download Protein FASTA

851 aa · TkA03G310280|TK1151|PROTEIN

MEAMVKVLFYLFFILLLLVNSVLTQSTVRPLSSGVERTALLDLRASLGIKARYWPRKLDPCANWTGVECGNGRVTGINLSGLRRTRVGRLSPSFSIDSLVRCTQLSTFNASGFALPGRIPDWLGQNLRALQVLDLTSSSIVGPIPPSIGSLNQLTLLLLADNSLTGNIPDSLRQLSSLSVLNLSLNMLTGSIPSSFSALANLTTLDFSSNFLSGPIPPTFGSFSGLQFLNLSNNSLASSIPVQLGNLSQLLDLDLGFNSF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G310280
TK1151 IDTkA03G310280
OH-1004 IDLXL04_008926
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)98.900
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G310280
LocationChr03:76262566-76266589 (-)
DescriptionSimilar to At2g16250: Probable LRR receptor-like serine/threonine-protein kinase At2g16250
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g16250 Probable LRR receptor-like serine/threonine-protein kinase At2g16250. No verified direct reference in this release
At3g13380 Receptor with a dual specificity kinase activity acting on both serine/threonine- and tyrosine-containing substrates.
BRL1 and BRL3 are novel brassinosteroid receptors that function in vascular differentiation in Arabidopsis.2004 · DOI: 10.1242/dev.01403
At3g24550 Proline-rich receptor-like protein kinase PERK1. No verified direct reference in this release
At3g24400 Proline-rich receptor-like protein kinase PERK2. No verified direct reference in this release
At1g68690 Could be involved in the negative regulation of root growth. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_008926 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009414 response to water deprivation Biological Process
GO:0009416 response to light stimulus Biological Process
GO:0009729 detection of brassinosteroid stimulus Biological Process
GO:0009742 brassinosteroid mediated signaling pathway Biological Process
GO:0009755 hormone-mediated signaling pathway Biological Process
GO:0009791 post-embryonic development Biological Process
GO:0005886 plasma membrane Cellular Component
GO:0009505 plant-type cell wall Cellular Component
GO:0009506 plasmodesma Cellular Component
GO:0004674 protein serine/threonine kinase activity Molecular Function
GO:0005496 steroid binding Molecular Function
GO:0005524 ATP binding Molecular Function
KEGG gene cross-reference
ath:AT1G55610
ath:AT2G16250
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.815
Rank 1 · TkA03G310280 · TK1151
Endoplasmic reticulum0.083
Rank 2 · TkA03G310280 · TK1151
Cytoplasm0.070
Rank 3 · TkA03G310280 · TK1151
Nucleus0.056
Rank 4 · TkA03G310280 · TK1151
Lysosome / Vacuole0.039
Rank 5 · TkA03G310280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_236-69 aa
PF12799LRR_495-112 aa
PF24758LRR_At5g5637097-140 aa
PF00560LRR_1105-125 aa
PF23211LRR_LRWD1107-186 aa
PF12799LRR_4118-141 aa
PF25019LRR_R13L1-DRL21118-159 aa
PF23598LRR_14120-183 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G310280PF08263LRRNT_236693.8e-0524.6
TkA03G310280PF12799LRR_4951127.7e-0833.1
TkA03G310280PF24758LRR_At5g56370971403.97.8
TkA03G310280PF00560LRR_11051251.7e-1760.4
TkA03G310280PF23211LRR_LRWD11071860.04814.1
TkA03G310280PF12799LRR_41181417.7e-0833.1
TkA03G310280PF25019LRR_R13L1-DRL211181590.01416.0
TkA03G310280PF23598LRR_141201832.5e-1660.1
TkA03G310280PF13855LRR_81251643.6e-1349.8
TkA03G310280PF13855LRR_81291883.6e-1349.8
TkA03G310280PF00560LRR_11301511.7e-1760.4
TkA03G310280PF13855LRR_81532103.6e-1349.8
TkA03G310280PF12799LRR_41531867.7e-0833.1
TkA03G310280PF00560LRR_11541751.7e-1760.4
TkA03G310280PF24758LRR_At5g563701602093.97.8
TkA03G310280PF25019LRR_R13L1-DRL211672330.01416.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
C0LGK4Arabidopsis thalianasp|C0LGK4|Y2165_ARATH Probable LRR receptor-like serine/threonine-protein kinase At2g1625052.800%Swiss-ProtHigh
Q9LJF3Arabidopsis thalianasp|Q9LJF3|BRL3_ARATH Receptor-like protein kinase BRI1-like 330.100%Swiss-ProtLow
Q9LV48Arabidopsis thalianasp|Q9LV48|PERK1_ARATH Proline-rich receptor-like protein kinase PERK134.000%Swiss-ProtLow
Q9LK03Arabidopsis thalianasp|Q9LK03|PERK2_ARATH Proline-rich receptor-like protein kinase PERK233.800%Swiss-ProtLow
Q9SX31Arabidopsis thalianasp|Q9SX31|PERK9_ARATH Proline-rich receptor-like protein kinase PERK933.200%Swiss-ProtLow

JBrowse

View in Genome Browser