RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G309510
Reference: TK1151 Chr: Chr03 Coordinates: 76094784-76096526 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

576 bp · TkA03G309510|TK1151|cDNA

ATGTCAAGCCGAACCGAAGTGCCGAAACATGTCAAGTTGAACCGAAGTAGCGGACCATGTCAAGCCGAACCGAAGTGCCAAACCATGTCAAGCCGAACCGAAGTGTCGAACCATGTCAAGTTAAACCGTACCATTATTGCCAAACCATGGTGGACGGCATGCCCCAAGCTCAACACTCTGAACTTGTCAAGAAACTTGATTGATTTTAATGGTGGTTTGAAACCGATTGGAATTTCTTTTCAGGTTATTGATCTGTCTTA...

CDS

Download CDS FASTA

576 bp · TkA03G309510|TK1151|CDS

ATGTCAAGCCGAACCGAAGTGCCGAAACATGTCAAGTTGAACCGAAGTAGCGGACCATGTCAAGCCGAACCGAAGTGCCAAACCATGTCAAGCCGAACCGAAGTGTCGAACCATGTCAAGTTAAACCGTACCATTATTGCCAAACCATGGTGGACGGCATGCCCCAAGCTCAACACTCTGAACTTGTCAAGAAACTTGATTGATTTTAATGGTGGTTTGAAACCGATTGGAATTTCTTTTCAGGTTATTGATCTGTCTTA...

Protein

Download Protein FASTA

191 aa · TkA03G309510|TK1151|PROTEIN

MSSRTEVPKHVKLNRSSGPCQAEPKCQTMSSRTEVSNHVKLNRTIIAKPWWTACPKLNTLNLSRNLIDFNGGLKPIGISFQVIDLSYNRISWGKPNVVRWILSNGCRELRHLSLKGNKVAEELPEFDCPNLEHIDLSVRVSDSLTSPRNILPARYHLFRSTATSSFCIYPTIISTVGFLHTSSIYAQFSWN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G309510
TK1151 IDTkA03G309510
OH-1004 IDLXL04_007580
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)88.500
Protein coverage (%)TK1151 45.550 / OH-1004 7.585
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G309510
LocationChr03:76094784-76096526 (-)
DescriptionSimilar to Systemin receptor SR160
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g39400 Receptor with a dual specificity kinase activity acting on both serine/threonine- and tyrosine-containing substrates.
Brassinosteroid-insensitive dwarf mutants of Arabidopsis accumulate brassinosteroids.1999 · DOI: 10.1104/pp.121.3.743
Brassinosteroid-insensitive-1 is a ubiquitously expressed leucine-rich repeat receptor serine/threonine kinase.2000 · DOI: 10.1104/pp.123.4.1247
The Arabidopsis transthyretin-like protein is a potential substrate of BRASSINOSTEROID-INSENSITIVE 1.2004 · DOI: 10.1105/tpc.104.023903
The Arabidopsis thaliana brassinosteroid receptor (AtBRI1) contains a domain that functions as a guanylyl cyclase in vitro.2007 · DOI: 10.1371/journal.pone.0000449
BSKs mediate signal transduction from the receptor kinase BRI1 in Arabidopsis.2008 · DOI: 10.1126/science.1156973
Tyrosine phosphorylation of the BRI1 receptor kinase emerges as a component of brassinosteroid signaling in Arabidopsis.2009 · DOI: 10.1073/pnas.0810249106
BSKs are partially redundant positive regulators of brassinosteroid signaling in Arabidopsis.2013 · DOI: 10.1111/tpj.12175

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_007580 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0001578 microtubule bundle formation Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009416 response to light stimulus Biological Process
GO:0009647 skotomorphogenesis Biological Process
GO:0009729 detection of brassinosteroid stimulus Biological Process
GO:0009742 brassinosteroid mediated signaling pathway Biological Process
GO:0009755 hormone-mediated signaling pathway Biological Process
GO:0009791 post-embryonic development Biological Process
GO:0009911 positive regulation of flower development Biological Process
GO:0010224 response to UV-B Biological Process
GO:0010268 brassinosteroid homeostasis Biological Process
GO:0010584 pollen exine formation Biological Process
KEGG gene cross-reference
ath:AT3G13380
ath:AT4G39400
dosa:Os01g0718300
sly:101261320
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.452
Rank 1 · TkA03G309510 · TK1151
Cytoplasm0.418
Rank 2 · TkA03G309510 · TK1151
Mitochondrion0.139
Rank 3 · TkA03G309510 · TK1151
Cell membrane0.079
Rank 4 · TkA03G309510 · TK1151
Endoplasmic reticulum0.054
Rank 5 · TkA03G309510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12799LRR_452-69 aa
PF13855LRR_852-68 aa
PF13516LRR_654-68 aa
PF00560LRR_156-71 aa
PF00560LRR_180-96 aa
PF12799LRR_481-91 aa
PF13855LRR_881-118 aa
PF13516LRR_681-91 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G309510PF12799LRR_452696.9e-1039.6
TkA03G309510PF13855LRR_852686.1e-0626.6
TkA03G309510PF13516LRR_654680.0001422.3
TkA03G309510PF00560LRR_156710.0002221.4
TkA03G309510PF00560LRR_180960.0002221.4
TkA03G309510PF12799LRR_481916.9e-1039.6
TkA03G309510PF13855LRR_8811186.1e-0626.6
TkA03G309510PF13516LRR_681910.0001422.3
TkA03G309510PF13516LRR_61061190.0001422.3
TkA03G309510PF12799LRR_41081376.9e-1039.6
TkA03G309510PF13855LRR_81091366.1e-0626.6
TkA03G309510PF00560LRR_11091250.0002221.4
TkA03G309510PF13516LRR_61281370.0001422.3
TkA03G309510PF00560LRR_11301370.0002221.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O22476Arabidopsis thalianasp|O22476|BRI1_ARATH Protein BRASSINOSTEROID INSENSITIVE 146.100%Swiss-ProtLow

JBrowse

View in Genome Browser