TkA03G286570 | RubberDandelionOmics

Gene overview

TkA03G286570

Reference: TK1151 Chr: Chr03 Coordinates: 70734032-70738058 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1529 bp · TkA03G286570|TK1151|cDNA

TGCACCCAGCGGCCAGCACCTTCAATGGCCAAACAGCTTCGCTTTTCCGATCACTCAACTGAAGTTCCCAAGCGTAATTACGATCAATTAAACATCGACTCGATACTTGAATCCCTGTTTGCTGTTTCCGATTACGGTTTAATCGACGCCTCATTCGATGGCCTGGTCAAATCTAGGTCTAGCGATTCCCACCAAGACGATTTTATCCAATGTGCTCTCCACCTCGGATCCGTGATACTCGAAGCTGGTAAGAGATCCGC...

CDS

Download CDS FASTA

1236 bp · TkA03G286570|TK1151|CDS

ATGGCCAAACAGCTTCGCTTTTCCGATCACTCAACTGAAGTTCCCAAGCGTAATTACGATCAATTAAACATCGACTCGATACTTGAATCCCTGTTTGCTGTTTCCGATTACGGTTTAATCGACGCCTCATTCGATGGCCTGGTCAAATCTAGGTCTAGCGATTCCCACCAAGACGATTTTATCCAATGTGCTCTCCACCTCGGATCCGTGATACTCGAAGCTGGTAAGAGATCCGCTCGTAAACGCTCCTCTGTTCATAA...

Protein

Download Protein FASTA

411 aa · TkA03G286570|TK1151|PROTEIN

MAKQLRFSDHSTEVPKRNYDQLNIDSILESLFAVSDYGLIDASFDGLVKSRSSDSHQDDFIQCALHLGSVILEAGKRSARKRSSVHNASVWPLPPHLTIKVFSMLDTTSVWSATATCLFFQKCAKDPFCYTNIDLAALVPKMRPKIIVPKINARVSTMIEQAGNALQSIKLCGPYYDEVATQEEMLPICSCLSSLSANGGAPGSRLKRLRLYNIGVPDGWGDATFVTKKISASLTVCPSLVEIKIVSTDVHISRILKSVS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G286570`
TK1151 ID	TkA03G286570
OH-1004 ID	LXL04_018814
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	92.700
Protein coverage (%)	TK1151 98.783 / OH-1004 91.784 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G286570

Location Chr03:70734032-70738058 (-)

Description Similar to SKIP17: F-box protein SKIP17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02740`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018814 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0019005 SCF ubiquitin ligase complex Cellular Component

KEGG gene cross-reference

ath:AT4G02733

ath:AT4G02740

ath:AT4G02760

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.847

Rank 1 · TkA03G286570 · TK1151

Cytoplasm0.154

Rank 2 · TkA03G286570 · TK1151

Cell membrane0.040

Rank 3 · TkA03G286570 · TK1151

Plastid0.029

Rank 4 · TkA03G286570 · TK1151

Endoplasmic reticulum0.025

Rank 5 · TkA03G286570 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937F-box-like93-135 aa

PF29594LRR_SKP2168-195 aa

PF29594LRR_SKP2225-359 aa

PF12937F-box-like270-288 aa

PF29594LRR_SKP2356-394 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G286570	`PF12937`	F-box-like	93	135	9.3e-06	26.0
TkA03G286570	`PF29594`	LRR_SKP2	168	195	7.7e-07	29.3
TkA03G286570	`PF29594`	LRR_SKP2	225	359	7.7e-07	29.3
TkA03G286570	`PF12937`	F-box-like	270	288	9.3e-06	26.0
TkA03G286570	`PF29594`	LRR_SKP2	356	394	7.7e-07	29.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WRC9`	Arabidopsis thaliana	sp\|Q0WRC9\|SKI17_ARATH F-box protein SKIP17	36.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card