TkA03G284930 | RubberDandelionOmics

Gene overview

TkA03G284930

Reference: TK1151 Chr: Chr03 Coordinates: 70322746-70324658 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1068 bp · TkA03G284930|TK1151|cDNA

TATATATTTTACATTTTATTTGATCAATATCCCTGTCTAATCTCTATCCACACGCATAGCGCACACAAACACTTCCAATGGCGCTTCTGCAATCCTCAGCTTCTTCTTTCATTTCTCAATTCCCGGCGGTTTCTCTAGGCAACTCGGTACGCTTATCTCCGCTGTCTGGGAACCGTTACGGCGGTTTATCCGTGAAGGCGGAAGCGGCGGCAGGGATAGTGTTGGTTGATAAATCCGAAGCGGATAAGGTTAATCGTCTC...

CDS

Download CDS FASTA

795 bp · TkA03G284930|TK1151|CDS

ATGGCGCTTCTGCAATCCTCAGCTTCTTCTTTCATTTCTCAATTCCCGGCGGTTTCTCTAGGCAACTCGGTACGCTTATCTCCGCTGTCTGGGAACCGTTACGGCGGTTTATCCGTGAAGGCGGAAGCGGCGGCAGGGATAGTGTTGGTTGATAAATCCGAAGCGGATAAGGTTAATCGTCTCAAAACATCCTACTTCGAGAAGATTATTCCTTTGCTCAAGGAAGAATTTAGTTACACTAACGTTCTTCAGGTCCCGAA...

Protein

Download Protein FASTA

264 aa · TkA03G284930|TK1151|PROTEIN

MALLQSSASSFISQFPAVSLGNSVRLSPLSGNRYGGLSVKAEAAAGIVLVDKSEADKVNRLKTSYFEKIIPLLKEEFSYTNVLQVPKLSKIVVNCGIGDAAQNSKGLDAAINDMALITGQRPVKTKAKNPIATFKIRENQTLGIAVTLRGNVMYAFLDRLINLGFPRTRDFQGVSPNSFDGHGNYSVGLKEQSVFPELSYDALGKPRGMDVCISTTAQTDKEAYKLLALMGMPFREGAGPSTVVRRKKLKSHHFNTKTKQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G284930`
TK1151 ID	TkA03G284930
OH-1004 ID	LXL04_026703
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G284930

Location Chr03:70322746-70324658 (+)

Description Similar to RPL5: 50S ribosomal protein L5, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g01310`	Binds 5S rRNA, forms part of the central protuberance of the 50S subunit.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0125000`	Binds 5S rRNA, forms part of the central protuberance of the 50S subunit.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026703 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0005762 mitochondrial large ribosomal subunit Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005840 ribosome Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0022625 cytosolic large ribosomal subunit Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0000049 tRNA binding Molecular Function

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT4G01310

cyn:Cyan7425_1304

dosa:Os03g0125000

syn:sll1808

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.956

Rank 1 · TkA03G284930 · TK1151

Mitochondrion0.063

Rank 2 · TkA03G284930 · TK1151

Nucleus0.018

Rank 3 · TkA03G284930 · TK1151

Cytoplasm0.016

Rank 4 · TkA03G284930 · TK1151

Cell membrane0.007

Rank 5 · TkA03G284930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00281Ribosomal_L581-137 aa

PF00673Ribosomal_L5_C142-234 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G284930	`PF00281`	Ribosomal_L5	81	137	1.3e-24	86.9
TkA03G284930	`PF00673`	Ribosomal_L5_C	142	234	4.7e-34	117.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04603`	Arabidopsis thaliana	sp\|O04603\|RK5_ARATH Large ribosomal subunit protein uL5c	68.100%	Swiss-Prot	High
`Q9ZST0`	Oryza sativa subsp. japonica	sp\|Q9ZST0\|RK5_ORYSJ Large ribosomal subunit protein uL5c	65.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card