TkA03G242840 | RubberDandelionOmics

Gene overview

TkA03G242840

Reference: TK1151 Chr: Chr03 Coordinates: 60442279-60455547 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2535 bp · TkA03G242840|TK1151|cDNA

ATGTTCAATCATATACTTGGAGAGTCTCTTGAAGCCCAGCTCCAACGGTTCACTACCCTCACCACGGAAATTAGCACTGCTGGCATTGTGTTGCCCAAATCAGAGATCAACAAGAAGCTGTTGAATTCTCTCCATGAAAAATGGGACATGAATGTCTTTGTGATAAAGAAGACCAGTGACCTGAACTCCATGACGCTCGCAGAAACTCTAGCTGTCATTAAATCCTTTGACATGGATGTTAAGCAGCGTGAGATTAATCG...

CDS

Download CDS FASTA

2535 bp · TkA03G242840|TK1151|CDS

ATGTTCAATCATATACTTGGAGAGTCTCTTGAAGCCCAGCTCCAACGGTTCACTACCCTCACCACGGAAATTAGCACTGCTGGCATTGTGTTGCCCAAATCAGAGATCAACAAGAAGCTGTTGAATTCTCTCCATGAAAAATGGGACATGAATGTCTTTGTGATAAAGAAGACCAGTGACCTGAACTCCATGACGCTCGCAGAAACTCTAGCTGTCATTAAATCCTTTGACATGGATGTTAAGCAGCGTGAGATTAATCG...

Protein

Download Protein FASTA

844 aa · TkA03G242840|TK1151|PROTEIN

MFNHILGESLEAQLQRFTTLTTEISTAGIVLPKSEINKKLLNSLHEKWDMNVFVIKKTSDLNSMTLAETLAVIKSFDMDVKQREINRASYNIGTSSNSAFAAQPSMVAPPQPSYTPKVQPPPTYSAESSSSVPAPYTTQMARGTEENLGIMTANCYNAVVNGELHPPVLMSELDQNYPDDVEEMEEMFGAVEVTARWGTTNNNDRALVAQQFSWEDQLNTLNLGDHHDHTANLAQTEEAEDQMMELQHAFMVSASTEEEK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G242840`
TK1151 ID	TkA03G242840
OH-1004 ID	LXL04_007375
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	46.300
Protein coverage (%)	TK1151 97.393 / OH-1004 70.127 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G242840`
Location	Chr03:60442279-60455547 (-)
Description	Similar to RE1: Retrovirus-related Pol polyprotein from transposon RE1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_007375` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006281 DNA repair Biological Process GO:0006310 DNA recombination Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0071897 DNA biosynthetic process Biological Process GO:0042575 DNA polymerase complex Cellular Component GO:0003676 nucleic acid binding Molecular Function GO:0003964 RNA-directed DNA polymerase activity Molecular Function GO:0004190 aspartic-type endopeptidase activity Molecular Function GO:0004519 endonuclease activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.572

Rank 1 · TkA03G242840 · TK1151

Nucleus0.442

Rank 2 · TkA03G242840 · TK1151

Mitochondrion0.069

Rank 3 · TkA03G242840 · TK1151

Cell membrane0.063

Rank 4 · TkA03G242840 · TK1151

Endoplasmic reticulum0.054

Rank 5 · TkA03G242840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14223Retrotran_gag_27-70 aa

PF29862ZTF17_M336-366 aa

PF30379SLU7_N348-359 aa

PF30379SLU7_N383-401 aa

PF14392zf-CCHC_4386-403 aa

PF00098zf-CCHC387-403 aa

PF29862ZTF17_M457-481 aa

PF22936Pol_BBD491-533 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G242840	`PF14223`	Retrotran_gag_2	7	70	0.00046	20.7
TkA03G242840	`PF29862`	ZTF17_M	336	366	0.71	11.0
TkA03G242840	`PF30379`	SLU7_N	348	359	0.0078	16.4
TkA03G242840	`PF30379`	SLU7_N	383	401	0.0078	16.4
TkA03G242840	`PF14392`	zf-CCHC_4	386	403	0.19	12.1
TkA03G242840	`PF00098`	zf-CCHC	387	403	1.2e-05	25.9
TkA03G242840	`PF29862`	ZTF17_M	457	481	0.71	11.0
TkA03G242840	`PF22936`	Pol_BBD	491	533	0.00081	20.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card