TkA03G197270 | RubberDandelionOmics

Gene overview

TkA03G197270

Reference: TK1151 Chr: Chr03 Coordinates: 49523682-49526038 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

917 bp · TkA03G197270|TK1151|cDNA

TTTTTATATTAAGCCCTTGGGTCGACGGCTAGTAAAATGCGTGAAAAGTAAGTGTTCGTGTTCTACAAGAATTCGGGATTCTTTCGATCAACCTCTCATTCTCCGGGACGATGTCTGCTGAATCTACTTCCTCAATCTTTAGGAACCAGGTGGATTTACTCGATTTCATAGACTGGACGGGAGTCGAATGCCTTAATCAGAACACCAGCCATCCTTTCACCAATGCCGTGAAACAGGGTTATAGAGAAGATGAGGGTCTG...

CDS

Download CDS FASTA

531 bp · TkA03G197270|TK1151|CDS

ATGTCTGCTGAATCTACTTCCTCAATCTTTAGGAACCAGGTGGATTTACTCGATTTCATAGACTGGACGGGAGTCGAATGCCTTAATCAGAACACCAGCCATCCTTTCACCAATGCCGTGAAACAGGGTTATAGAGAAGATGAGGGTCTGAATCTGGAGAGTGATGCAGATGAGCAGCTTCTGATTTACATACCATTTACTCAAGTTATCAAACTGCATTCTATTGTCATTAAAGGGCCTGAGGAGGAAGGCCCTCAAAC...

Protein

Download Protein FASTA

176 aa · TkA03G197270|TK1151|PROTEIN

MSAESTSSIFRNQVDLLDFIDWTGVECLNQNTSHPFTNAVKQGYREDEGLNLESDADEQLLIYIPFTQVIKLHSIVIKGPEEEGPQTVKLYTNREHMGFSNVGDFPPSDTLALSPENLKGKPVVLKYVKFQNVRSLTIFIEDNQSGSELTKVQKIVLQGTTVETTDMKGLKKIEDH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G197270`
TK1151 ID	TkA03G197270
OH-1004 ID	LXL04_007616
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G197270

Location Chr03:49523682-49526038 (+)

Description Similar to At3g04780: PITH domain-containing protein At3g04780

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g04780`	PITH domain-containing protein At3g04780.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007616 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0000502 proteasome complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0034399 nuclear periphery Cellular Component

GO:0015035 protein-disulfide reductase activity Molecular Function

GO:0015036 disulfide oxidoreductase activity Molecular Function

KEGG gene cross-reference

ath:AT3G04780

hsa:9352

mmu:53382

rno:140922

spo:2541028

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.740

Rank 1 · TkA03G197270 · TK1151

Cytoplasm0.604

Rank 2 · TkA03G197270 · TK1151

Mitochondrion0.040

Rank 3 · TkA03G197270 · TK1151

Cell membrane0.029

Rank 4 · TkA03G197270 · TK1151

Endoplasmic reticulum0.027

Rank 5 · TkA03G197270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06201PITH10-173 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G197270	`PF06201`	PITH	10	173	4.9e-53	180.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SQZ9`	Arabidopsis thaliana	sp\|Q9SQZ9\|PITH1_ARATH PITH domain-containing protein At3g04780	82.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card