TkA03G189020 | RubberDandelionOmics

Gene overview

TkA03G189020

Reference: TK1151 Chr: Chr03 Coordinates: 47588503-47591107 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1566 bp · TkA03G189020|TK1151|cDNA

ATGAGGTTCACAAAAAAATCAGCGAAAAGGTTATCCGAACCTATGGAAGAACCAAGCAACAACAGATTGCCTAGGAGATCAGAAAGAAACTTGTCTATAACTAATCAAAGAGACACAGAAACTATTCAAACCAATAAACGTAATGTGCCAAGTAAAAAGAACAAGAGAAAGAAAAGAACTGCAGAAGCATCTACATCTACTCAAAATGTTTTTCATTACATGAAGAACAGATGCTCTACATCATGCTTGTACACAATAAT...

CDS

Download CDS FASTA

1566 bp · TkA03G189020|TK1151|CDS

ATGAGGTTCACAAAAAAATCAGCGAAAAGGTTATCCGAACCTATGGAAGAACCAAGCAACAACAGATTGCCTAGGAGATCAGAAAGAAACTTGTCTATAACTAATCAAAGAGACACAGAAACTATTCAAACCAATAAACGTAATGTGCCAAGTAAAAAGAACAAGAGAAAGAAAAGAACTGCAGAAGCATCTACATCTACTCAAAATGTTTTTCATTACATGAAGAACAGATGCTCTACATCATGCTTGTACACAATAAT...

Protein

Download Protein FASTA

521 aa · TkA03G189020|TK1151|PROTEIN

MRFTKKSAKRLSEPMEEPSNNRLPRRSERNLSITNQRDTETIQTNKRNVPSKKNKRKKRTAEASTSTQNVFHYMKNRCSTSCLYTIIQTMSKEQKQCVRNMGFGELLNMKVIEVSGTLSCYMLERFNATTMTIALPCGTINLTRETVHDIMGLPMGATKITELPFRSPEHTSYTDWYNQFNKTHVRINDVKRKIIESTNIDINFKLNFLVLMINSLIESSSYGKANLDILNYVTEDVDITDLDWCSLLLDSLTRNKLIYN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G189020`
TK1151 ID	TkA03G189020
OH-1004 ID	LXL04_028197
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	89.800
Protein coverage (%)	TK1151 94.050 / OH-1004 59.709 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G189020`
Location	Chr03:47588503-47591107 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_028197` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.887

Rank 1 · TkA03G189020 · TK1151

Cytoplasm0.187

Rank 2 · TkA03G189020 · TK1151

Mitochondrion0.030

Rank 3 · TkA03G189020 · TK1151

Cell membrane0.022

Rank 4 · TkA03G189020 · TK1151

Extracellular0.013

Rank 5 · TkA03G189020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08783DWNN21-51 aa

PF10536PMD48-80 aa

PF26774KH_I_RBM4369-79 aa

PF29561DUF856677-276 aa

PF10536PMD102-279 aa

PF26774KH_I_RBM43178-190 aa

PF08783DWNN179-200 aa

PF26774KH_I_RBM43303-350 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G189020	`PF08783`	DWNN	21	51	0.17	12.9
TkA03G189020	`PF10536`	PMD	48	80	2.4	7.9
TkA03G189020	`PF26774`	KH_I_RBM43	69	79	0.21	12.3
TkA03G189020	`PF29561`	DUF8566	77	276	3.4e-42	145.2
TkA03G189020	`PF10536`	PMD	102	279	2.4	7.9
TkA03G189020	`PF26774`	KH_I_RBM43	178	190	0.21	12.3
TkA03G189020	`PF08783`	DWNN	179	200	0.17	12.9
TkA03G189020	`PF26774`	KH_I_RBM43	303	350	0.21	12.3
TkA03G189020	`PF27159`	HI_1054_N	307	347	0.023	15.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card