TkA03G183500 | RubberDandelionOmics

Gene overview

TkA03G183500

Reference: TK1151 Chr: Chr03 Coordinates: 46211532-46215807 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1444 bp · TkA03G183500|TK1151|cDNA

TATAAAACTACTATTTTCAAAAGGAGGTGTGGTCTTCGATCGAATTCGATTCTTCTCATCAATCAAGAAACGGAAGTTAGGGTTTTGAACAATCGATTTATCTCAGTTTGCTGTATCTTGAATTGGTCGAGTTCACAAAGTTCAAACTTTTCATTTACTCGATACAGGCTCATAATTTTGCTTTAATGTATCTCAACTCAAAGAGGATGGATGTATATGAGCCGATGCACCAATTTAGCATGTGGGGAGATTTCAAAGGC...

CDS

Download CDS FASTA

1080 bp · TkA03G183500|TK1151|CDS

ATGAATTCATCATCCACTCAGTATCTCAACTCAAAGAGGATGGATGTATATGAGCCGATGCACCAATTTAGCATGTGGGGAGATTTCAAAGGCAACATCTATCAAGACACATCTGCCACCATGATTATAGAGATGGATACAAAGCTAGACAACCAGTCAGAGGATGCTTCACACACAACAATCGGACCTTCAAATCACTTTGATCAAGAAGCAAGTAAACCAGGTGATAAGGTTCTAAGAAGACTTGCACAAAATCGCGA...

Protein

Download Protein FASTA

359 aa · TkA03G183500|TK1151|PROTEIN

MNSSSTQYLNSKRMDVYEPMHQFSMWGDFKGNIYQDTSATMIIEMDTKLDNQSEDASHTTIGPSNHFDQEASKPGDKVLRRLAQNREAARKSRLRKKAYVQQLEASRLKLLHLEQELEQTRAQAALLSGGVNASHPGLPRAASSGIAAFEMEYEQWVEEQNKKTNALKTALNAPLPDTEIDILVKDTLNHYANLFNIKATAAKIDVCYLISGMWKTSTERLFLWIGGFRPSELLKVLVPQLELLDQQSHDLGNLIQACQQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G183500`
TK1151 ID	TkA03G183500
OH-1004 ID	LXL04_007486
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G183500

Location Chr03:46211532-46215807 (+)

Description Similar to TGA1A: TGACG-sequence-specific DNA-binding protein TGA-1A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g10030`	Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'.	No verified direct reference in this release
`At5g65210`	Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'.	No verified direct reference in this release
`At1g77920`	Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0637000`	Transcriptional regulator involved in defense response.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007486 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G77920

ath:AT5G10030

ath:AT5G65210

dosa:Os04g0637000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.673

Rank 1 · TkA03G183500 · TK1151

Cytoplasm0.350

Rank 2 · TkA03G183500 · TK1151

Cell membrane0.055

Rank 3 · TkA03G183500 · TK1151

Mitochondrion0.038

Rank 4 · TkA03G183500 · TK1151

Endoplasmic reticulum0.037

Rank 5 · TkA03G183500 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27682ICR5_C70-123 aa

PF00170bZIP_176-112 aa

PF03131bZIP_Maf78-123 aa

PF07716bZIP_279-120 aa

PF28673bZIP_CREBRF_C81-120 aa

PF19303Anticodon_3133-195 aa

PF14144DOG1165-238 aa

PF03131bZIP_Maf251-273 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G183500	`PF27682`	ICR5_C	70	123	0.096	14.2
TkA03G183500	`PF00170`	bZIP_1	76	112	5.4e-09	36.7
TkA03G183500	`PF03131`	bZIP_Maf	78	123	0.13	13.6
TkA03G183500	`PF07716`	bZIP_2	79	120	2.4e-05	25.0
TkA03G183500	`PF28673`	bZIP_CREBRF_C	81	120	0.011	16.8
TkA03G183500	`PF19303`	Anticodon_3	133	195	0.13	12.8
TkA03G183500	`PF14144`	DOG1	165	238	1.3e-25	90.0
TkA03G183500	`PF03131`	bZIP_Maf	251	273	0.13	13.6
TkA03G183500	`PF27682`	ICR5_C	255	325	0.096	14.2
TkA03G183500	`PF14144`	DOG1	256	276	1.3e-25	90.0
TkA03G183500	`PF28673`	bZIP_CREBRF_C	263	274	0.011	16.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39162`	Arabidopsis thaliana	sp\|Q39162\|TGA4_ARATH Transcription factor TGA4	57.800%	Swiss-Prot	High
`Q39237`	Arabidopsis thaliana	sp\|Q39237\|TGA1_ARATH Transcription factor TGA1	56.600%	Swiss-Prot	High
`Q93ZE2`	Arabidopsis thaliana	sp\|Q93ZE2\|TGA7_ARATH Transcription factor TGA7	49.500%	Swiss-Prot	Medium
`A0A0P0WFC8`	Oryza sativa subsp. japonica	sp\|A0A0P0WFC8\|TGAL6_ORYSJ Transcription factor TGAL6	50.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card