TkA03G181120 | RubberDandelionOmics

Gene overview

TkA03G181120

Reference: TK1151 Chr: Chr03 Coordinates: 45673149-45675156 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1507 bp · TkA03G181120|TK1151|cDNA

ATTTGTCTCTCCATTTCCTGCCCAATTCTCAGTAGGTTTTTGACCCGCACAAAAACCCCTCAAAGAGGTTTTGGTCATTTCCCAAAACAATTTGAAACCAGACTCCTACCGGCCGGTCACTCGGTTTGGGGCTCCGCCGTCGAAGCCTTCAGAATGGGTTCATGCGTAAACACTTTCTCACTCCATTATCCTCGACGCCTTCTTGCATATCCCCAATCTCAAACACACCTTCAACAAAAATTTTCAAGGCTACTCCAAAA...

CDS

Download CDS FASTA

1212 bp · TkA03G181120|TK1151|CDS

ATTTGTCTCTCCATTTCCTGCCCAATTCTCAGTAGGTTTTTGACCCGCACAAAAACCCCTCAAAGAGGTTTTGGTCATTTCCCAAAACAATTTGAAACCAGACTCCTACCGGCCGGTCACTCGGTTTGGGGCTCCGCCGTCGAAGCCTTCAGAATGGGTTCATGCGTAAACACTTTCTCACTCCATTATCCTCGACGCCTTCTTGCATATCCCCAATCTCAAACACACCTTCAACAAAAATTTTCAAGGCTACTCCAAAA...

Protein

Download Protein FASTA

403 aa · TkA03G181120|TK1151|PROTEIN

ICLSISCPILSRFLTRTKTPQRGFGHFPKQFETRLLPAGHSVWGSAVEAFRMGSCVNTFSLHYPRRLLAYPQSQTHLQQKFSRLLQNSLYFNSIIKFPPKPTSIITYLKKPISYYPLISSSSSPYKGITKFVSERIAILLVGSFIFMGCFSKKPVLAQPVHESTQTQTSETQSDEFDEEETLYMRLLEGNPKSVEALKSVFHAKMKRGKTKEAIKYVERLITIEPKEVEWRLLQALCYEMIGEYSKAKSYFKSILKERPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G181120`
TK1151 ID	TkA03G181120
OH-1004 ID	LXL04_025854
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	27.800
Protein coverage (%)	TK1151 60.794 / OH-1004 73.538 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G181120

Location Chr03:45673149-45675156 (-)

Description Similar to SG1: protein SLOW GREEN 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g18420`	Required for the early stage of chloroplast development.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025854 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009658 chloroplast organization Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009941 chloroplast envelope Cellular Component

KEGG gene cross-reference

ath:AT3G18420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.910

Rank 1 · TkA03G181120 · TK1151

Mitochondrion0.078

Rank 2 · TkA03G181120 · TK1151

Nucleus0.042

Rank 3 · TkA03G181120 · TK1151

Cytoplasm0.023

Rank 4 · TkA03G181120 · TK1151

Cell membrane0.011

Rank 5 · TkA03G181120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09273Rubis-subs-bind165-247 aa

PF16266DUF4919167-220 aa

PF23914TPR_CcmH_CycH169-223 aa

PF13428TPR_14172-197 aa

PF30153TPR_YpiA_C172-226 aa

PF25064ARM_TT21_5th174-221 aa

PF30990TTC22_N174-223 aa

PF31234TPR_Psidin_N175-198 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G181120	`PF09273`	Rubis-subs-bind	165	247	0.2	13.1
TkA03G181120	`PF16266`	DUF4919	167	220	0.0002	22.0
TkA03G181120	`PF23914`	TPR_CcmH_CycH	169	223	0.0021	18.6
TkA03G181120	`PF13428`	TPR_14	172	197	6.7e-12	45.6
TkA03G181120	`PF30153`	TPR_YpiA_C	172	226	0.51	11.8
TkA03G181120	`PF25064`	ARM_TT21_5th	174	221	3.4e-08	34.5
TkA03G181120	`PF30990`	TTC22_N	174	223	2.4e-05	24.8
TkA03G181120	`PF31234`	TPR_Psidin_N	175	198	0.00036	20.8
TkA03G181120	`PF01239`	PPTA	177	193	0.036	14.5
TkA03G181120	`PF13431`	TPR_17	182	214	4.5e-08	33.5
TkA03G181120	`PF29810`	TP_0763	182	265	0.0014	19.4
TkA03G181120	`PF25060`	ARM_TT21_2nd	183	248	0.00059	20.1
TkA03G181120	`PF14559`	TPR_19	185	236	4.3e-09	37.3
TkA03G181120	`PF09613`	HrpB1_HrpK	186	259	0.029	14.8
TkA03G181120	`PF16918`	PknG_TPR	191	257	2.7e-05	23.8
TkA03G181120	`PF16266`	DUF4919	192	252	0.0002	22.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LS48`	Arabidopsis thaliana	sp\|Q9LS48\|SG1_ARATH protein SLOW GREEN 1, chloroplastic	34.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card