TkA03G167950 | RubberDandelionOmics

Gene overview

TkA03G167950

Reference: TK1151 Chr: Chr03 Coordinates: 42507322-42507705 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

384 bp · TkA03G167950|TK1151|cDNA

ATGGAGTCAGGATCCGTACTTGATCGAGCTAATTGCAGAGCAACAGGAGGTGCACCCAGATTCAAAGTCGCTATTCTAGGAGCTGCTGGAGGAATCGGTCAACCTCAATCCGGAAGACAGATCAGTTGTCGGTTTGATTTTGGAGAACGGAATGAACCAAAAGAAGAGGAACCATATGCAAAAATTAAATTCTCATTTTCGGAAAACAACATAGATTGCCAGAGAAAGAATAATCCTATTTGGAAAGAAGCAAGTCATGT...

CDS

Download CDS FASTA

384 bp · TkA03G167950|TK1151|CDS

ATGGAGTCAGGATCCGTACTTGATCGAGCTAATTGCAGAGCAACAGGAGGTGCACCCAGATTCAAAGTCGCTATTCTAGGAGCTGCTGGAGGAATCGGTCAACCTCAATCCGGAAGACAGATCAGTTGTCGGTTTGATTTTGGAGAACGGAATGAACCAAAAGAAGAGGAACCATATGCAAAAATTAAATTCTCATTTTCGGAAAACAACATAGATTGCCAGAGAAAGAATAATCCTATTTGGAAAGAAGCAAGTCATGT...

Protein

Download Protein FASTA

127 aa · TkA03G167950|TK1151|PROTEIN

MESGSVLDRANCRATGGAPRFKVAILGAAGGIGQPQSGRQISCRFDFGERNEPKEEEPYAKIKFSFSENNIDCQRKNNPIWKEASHVNKVIQRAFFLFHLFLISTLDKSAIFVLFYLTIFFCFSFIV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G167950`
TK1151 ID	TkA03G167950
OH-1004 ID	LXL04_007416
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	95.000
Protein coverage (%)	TK1151 62.992 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G167950

Location Chr03:42507322-42507705 (+)

Description Similar to MDHG: Malate dehydrogenase, glyoxysomal

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g22780`	Catalyzes a reversible NAD-dependent dehydrogenase reaction involved in central metabolism and redox homeostasis between organelle compartments (Probable).	Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported by peroxisomal hydroxypyruvate reductase when malate dehydrogenase is absent.2010 · DOI: 10.1007/s11103-009-9554-2
`At5g09660`	Catalyzes a reversible NAD-dependent dehydrogenase reaction involved in central metabolism and redox homeostasis between organelle compartments (Probable).	Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported by peroxisomal hydroxypyruvate reductase when malate dehydrogenase is absent.2010 · DOI: 10.1007/s11103-009-9554-2

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0632700`	Malate dehydrogenase, glyoxysomal.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007416 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006097 glyoxylate cycle Biological Process

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006108 malate metabolic process Biological Process

GO:0031998 regulation of fatty acid beta-oxidation Biological Process

GO:0080093 regulation of photorespiration Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009514 glyoxysome Cellular Component

GO:0030060 L-malate dehydrogenase (NAD+) activity Molecular Function

KEGG gene cross-reference

ath:AT2G22780

bna:106382950

csv:101219252

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.368

Rank 1 · TkA03G167950 · TK1151

Nucleus0.284

Rank 2 · TkA03G167950 · TK1151

Mitochondrion0.237

Rank 3 · TkA03G167950 · TK1151

Cell membrane0.094

Rank 4 · TkA03G167950 · TK1151

Plastid0.082

Rank 5 · TkA03G167950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82399`	Arabidopsis thaliana	sp\|O82399\|MDHX1_ARATH Malate dehydrogenase 1, peroxisomal	71.400%	Swiss-Prot	Low
`Q9ZP05`	Arabidopsis thaliana	sp\|Q9ZP05\|MDHX2_ARATH Malate dehydrogenase 2, peroxisomal	75.800%	Swiss-Prot	Low
`Q42972`	Oryza sativa subsp. japonica	sp\|Q42972\|MDHG_ORYSJ Malate dehydrogenase, glyoxysomal	68.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card