Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1316 bp · TkA03G130830|TK1151|cDNA
AAGCGCTTTAAACCTCTATATATTCACATCAATACCATAATCGTTTCTCTCATCAATCAACCTCAAACTCTCTCTTTTCTTCTTCTTCTTCTTCTTCTTCAAGTCAACTTATATTCAAAAACCTTTACATCAATGGCACAAAAAAGCAAGATCTTGATCATAGGAGGGACTGGATACATTGGAAAATTTGTAGCAGAAGCAAGTGCCAAACAAGGGCATCCAACTTTCATTTTCACCAGAGAAAGCACAACCAAACATCC...
1059 bp · TkA03G130830|TK1151|CDS
AAGCGCTTTAAACCTCTATATATTCACATCAATACCATAATCGTTTCTCTCATCAATCAACCTCAAACTCTCTCTTTTCTTCTTCTTCTTCTTCTTCTTCAAGTCAACTTATATTCAAAAACCTTTACATCAATGGCACAAAAAAGCAAGATCTTGATCATAGGAGGGACTGGATACATTGGAAAATTTGTAGCAGAAGCAAGTGCCAAACAAGGGCATCCAACTTTCATTTTCACCAGAGAAAGCACAACCAAACATCC...
Protein
Download Protein FASTA352 aa · TkA03G130830|TK1151|PROTEIN
KRFKPLYIHINTIIVSLINQPQTLSFLLLLLLLQVNLYSKTFTSMAQKSKILIIGGTGYIGKFVAEASAKQGHPTFIFTRESTTKHPEKSKLLDNFKSLGAKLVIGDLHDHGSLVKAIKEVDVVISTVGGESVADQVKIIEAIKEAGNVKRFLPSEFGTDVDHVISVEPATSIFKGKADIRRAVEAAGIPHTFVSCNGFAGYFLPNIGQMDSYTAPREKVTILGDGTPKAVFVKEEEIALATIKSVDDPRTLNKILIFRP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G130830 |
|---|---|
| TK1151 ID | TkA03G130830 |
| OH-1004 ID | LXL04_007181 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 98.700 |
| Protein coverage (%) | TK1151 87.500 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G130830 |
|---|---|
| Location | Chr03:33566045-33568554 (+) |
| Description | Similar to PYRC5: Phenylcoumaran benzylic ether reductase Pyrc5 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0009699 phenylpropanoid biosynthetic process Biological Process GO:0009733 response to auxin Biological Process GO:0009753 response to jasmonic acid Biological Process GO:0009807 lignan biosynthetic process Biological Process GO:0009820 alkaloid metabolic process Biological Process GO:0042179 nicotine biosynthetic process Biological Process GO:0044550 secondary metabolite biosynthetic process Biological Process GO:0005737 cytoplasm Cellular Component GO:0000166 nucleotide binding Molecular Function GO:0016491 oxidoreductase activity Molecular Function GO:0032442 phenylcoumaran benzylic ether reductase activity Molecular Function GO:0050661 NADP binding Molecular Function |
| KEGG gene cross-reference | nsy:104247368 nta:107784748 nta:107807959 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01488Shikimate_DH41-145 aaPF00291PALP45-120 aaPF05368NmrA47-348 aaPF01118Semialdhyde_dh50-139 aaPF03807F420_oxidored50-137 aaPF01370Epimerase51-139 aaPF08659KR51-124 aaPF03435Sacchrp_dh_NADP51-133 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G130830 | PF01488 | Shikimate_DH | 41 | 145 | 0.23 | 12.3 |
| TkA03G130830 | PF00291 | PALP | 45 | 120 | 0.074 | 13.1 |
| TkA03G130830 | PF05368 | NmrA | 47 | 348 | 6.4e-84 | 282.8 |
| TkA03G130830 | PF01118 | Semialdhyde_dh | 50 | 139 | 0.12 | 13.5 |
| TkA03G130830 | PF03807 | F420_oxidored | 50 | 137 | 0.21 | 12.9 |
| TkA03G130830 | PF01370 | Epimerase | 51 | 139 | 3.9e-10 | 40.3 |
| TkA03G130830 | PF08659 | KR | 51 | 124 | 0.0002 | 22.1 |
| TkA03G130830 | PF03435 | Sacchrp_dh_NADP | 51 | 133 | 0.00029 | 21.9 |
| TkA03G130830 | PF00106 | adh_short | 51 | 130 | 0.011 | 16.0 |
| TkA03G130830 | PF02719 | Polysacc_synt_2 | 51 | 126 | 0.021 | 14.8 |
| TkA03G130830 | PF16363 | GDP_Man_Dehyd | 52 | 123 | 1.5e-06 | 28.7 |
| TkA03G130830 | PF01073 | 3Beta_HSD | 52 | 142 | 9.4e-05 | 22.3 |
| TkA03G130830 | PF02737 | 3HCDH_N | 53 | 155 | 0.025 | 15.2 |
| TkA03G130830 | PF02254 | TrkA_N | 53 | 148 | 0.045 | 14.8 |
| TkA03G130830 | PF13460 | NAD_binding_10 | 55 | 198 | 1.7e-13 | 51.6 |
| TkA03G130830 | PF14451 | Ub-Mut7C | 63 | 86 | 0.025 | 15.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.