TkA03G097180 | RubberDandelionOmics

Gene overview

TkA03G097180

Reference: TK1151 Chr: Chr03 Coordinates: 24645198-24649378 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2505 bp · TkA03G097180|TK1151|cDNA

CTCCGAACTACGGCCTGTCCCGTTGTTTAAACTTTTAAGGTTTAAACCCTCAAAAGCCCTAAAAAGCATACACCCTCATAACTTTCACATCACATCTCCGGCGAAATGCCAGGCCTTCTTACAGGTTCCGGTGATTCTTCCGCCCTCGTTCCCTTTTCTCCGGAAGCCAACACTCTCTGCAGTATATCCTCTCCACCACGGCCTTCAACCCCCAATCGCTCCTCGTCTCTCAATTTCATGGTCAAGTGGTAACTCGATTC...

CDS

Download CDS FASTA

1011 bp · TkA03G097180|TK1151|CDS

ATGCATGTTCTAGCTCAAAAATGCATGCAACTAAAACCTACATCTAGTCCACATAAGCTCATGAATCTCATAGTTGGGATTCTTGGAGAAAATACAGAGGTAGTATTAGCCGAGTGCTCAAAATCATTTGGACCTTGGATGATTGCTCATGCCACAGAGTTGCTGACAGTTGGCAGTATTCAAGCTGAAATTCTTTTAAAAGAAGAACGTGATAATTTAGGGGGAGTTAGCATAGAGGAATCTCATAGACTTGTTTATGC...

Protein

Download Protein FASTA

336 aa · TkA03G097180|TK1151|PROTEIN

MHVLAQKCMQLKPTSSPHKLMNLIVGILGENTEVVLAECSKSFGPWMIAHATELLTVGSIQAEILLKEERDNLGGVSIEESHRLVYAQVLSSHALTWQIAPIYLISCMKHGVGLLEILLYKQPVYHSQILLKNIEICRLYDLDSASANAMKIAGVHDWKHGRKGSGIFWLQQAGDELRLNRIAQTLFDFVGKSISDESFEQWEGLIELMGSESRTAGGLEFLHKYRDFKKSLQQVEGGGVTDAARKTCESLILIMKNPST...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G097180`
TK1151 ID	TkA03G097180
OH-1004 ID	LXL04_005250
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 46.602 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G097180

Location Chr03:24645198-24649378 (+)

Description Similar to NUP85: Nuclear pore complex protein NUP85

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32910`	Functions as a component of the nuclear pore complex (NPC).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005250 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006406 mRNA export from nucleus Biological Process

GO:0006606 protein import into nucleus Biological Process

GO:0006913 nucleocytoplasmic transport Biological Process

GO:0006935 chemotaxis Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0019221 cytokine-mediated signaling pathway Biological Process

GO:0030032 lamellipodium assembly Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0000776 kinetochore Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT4G32910

dre:445231

hsa:79902

mmu:445007

rno:287830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.519

Rank 1 · TkA03G097180 · TK1151

Cytoplasm0.360

Rank 2 · TkA03G097180 · TK1151

Lysosome / Vacuole0.103

Rank 3 · TkA03G097180 · TK1151

Cell membrane0.095

Rank 4 · TkA03G097180 · TK1151

Golgi apparatus0.084

Rank 5 · TkA03G097180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07575Nucleopor_Nup851-298 aa

PF27612WHD_RepA_N102-148 aa

PF27612WHD_RepA_N222-233 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G097180	`PF07575`	Nucleopor_Nup85	1	298	1.7e-68	232.4
TkA03G097180	`PF27612`	WHD_RepA_N	102	148	0.046	14.2
TkA03G097180	`PF27612`	WHD_RepA_N	222	233	0.046	14.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXH2`	Arabidopsis thaliana	sp\|Q8RXH2\|NUP85_ARATH Nuclear pore complex protein NUP85	69.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card