TkA03G090680 | RubberDandelionOmics

Gene overview

TkA03G090680

Reference: TK1151 Chr: Chr03 Coordinates: 23094529-23095036 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

354 bp · TkA03G090680|TK1151|cDNA

GTCTCAGTCGGTAAAGAACGAAGAGAAGCTTTATTCAGAACCAAACGATTATGTAGAGCAGGAGTCAGCACCGATACAGACATTCCCATTGATGATAACGACATGATGATAGAAGAAGAACAATCAATTCTAGAGTCCCAAACTACTTCAGCTGTCCAAGAATTAAACCTTGCAATCACCTTCCAGGGAAAAGGTGCAGTCCAAAAAAAGGTCAATGCTCTTCGTGAACTAAGACGCTTATTATCAAAATCTGGAGCTAT...

CDS

Download CDS FASTA

354 bp · TkA03G090680|TK1151|CDS

GTCTCAGTCGGTAAAGAACGAAGAGAAGCTTTATTCAGAACCAAACGATTATGTAGAGCAGGAGTCAGCACCGATACAGACATTCCCATTGATGATAACGACATGATGATAGAAGAAGAACAATCAATTCTAGAGTCCCAAACTACTTCAGCTGTCCAAGAATTAAACCTTGCAATCACCTTCCAGGGAAAAGGTGCAGTCCAAAAAAAGGTCAATGCTCTTCGTGAACTAAGACGCTTATTATCAAAATCTGGAGCTAT...

Protein

Download Protein FASTA

118 aa · TkA03G090680|TK1151|PROTEIN

VSVGKERREALFRTKRLCRAGVSTDTDIPIDDNDMMIEEEQSILESQTTSAVQELNLAITFQGKGAVQKKVNALRELRRLLSKSGAIPLLAQCLSFGSQDEQLLETTWCLTNIAAGKP

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G090680`
TK1151 ID	TkA03G090680
OH-1004 ID	LXL04_006931
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 23.459 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G090680

Location Chr03:23094529-23095036 (+)

Description Similar to IMPA9: Importin subunit alpha-9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g03070`	Binds to conventional NLS motifs and mediates nuclear protein import across the nuclear envelope (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0158000`	Binds specifically and directly to substrates containing either a simple or bipartite NLS motif.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006931 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006606 protein import into nucleus Biological Process

GO:0006607 NLS-bearing protein import into nucleus Biological Process

GO:0006999 nuclear pore organization Biological Process

GO:0007127 meiosis I Biological Process

GO:0007276 gamete generation Biological Process

GO:0007292 female gamete generation Biological Process

GO:0009555 pollen development Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0055046 microgametogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005643 nuclear pore Cellular Component

KEGG gene cross-reference

ath:AT3G11330

ath:AT5G03070

ath:AT5G05850

cel:CELE_F32E10.4

dosa:Os01g0158000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.564

Rank 1 · TkA03G090680 · TK1151

Nucleus0.543

Rank 2 · TkA03G090680 · TK1151

Mitochondrion0.057

Rank 3 · TkA03G090680 · TK1151

Cell membrane0.037

Rank 4 · TkA03G090680 · TK1151

Endoplasmic reticulum0.033

Rank 5 · TkA03G090680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19071DUF57675-50 aa

PF19071DUF576768-85 aa

PF00514Arm70-84 aa

PF00514Arm76-115 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G090680	`PF19071`	DUF5767	5	50	0.24	11.9
TkA03G090680	`PF19071`	DUF5767	68	85	0.24	11.9
TkA03G090680	`PF00514`	Arm	70	84	1.8e-05	25.3
TkA03G090680	`PF00514`	Arm	76	115	1.8e-05	25.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4KF65`	Arabidopsis thaliana	sp\|F4KF65\|IMPA9_ARATH Importin subunit alpha-9	62.000%	Swiss-Prot	High
`Q9FYP9`	Oryza sativa subsp. japonica	sp\|Q9FYP9\|IMAP2_ORYSJ Importin subunit alpha-2	54.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card