TkA03G087120 | RubberDandelionOmics

Gene overview

TkA03G087120

Reference: TK1151 Chr: Chr03 Coordinates: 22210097-22211295 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

471 bp · TkA03G087120|TK1151|cDNA

CTTTCAAGTAATGAGAGTTCTTTCCACCAAGAAAGATTGTATGTTAACAAACTTAACATTATACTGGTTCAGATATTGAAACATGAGTGGCCAGCCAGGTGGCGAAGCTTCATTCCCGACCTAGTTGTAGCAGCTAAAACCAGTGAAACAATTTGCGAAAATTGCATGGCTATACTGAAAGTAACTTTCACATACTCTTTTTCCTTATTTCTTGTTTCTTATCTTCTTTTTACATATGGGTATGAAAAGAATCTTAAAGA...

CDS

Download CDS FASTA

471 bp · TkA03G087120|TK1151|CDS

CTTTCAAGTAATGAGAGTTCTTTCCACCAAGAAAGATTGTATGTTAACAAACTTAACATTATACTGGTTCAGATATTGAAACATGAGTGGCCAGCCAGGTGGCGAAGCTTCATTCCCGACCTAGTTGTAGCAGCTAAAACCAGTGAAACAATTTGCGAAAATTGCATGGCTATACTGAAAGTAACTTTCACATACTCTTTTTCCTTATTTCTTGTTTCTTATCTTCTTTTTACATATGGGTATGAAAAGAATCTTAAAGA...

Protein

Download Protein FASTA

156 aa · TkA03G087120|TK1151|PROTEIN

LSSNESSFHQERLYVNKLNIILVQILKHEWPARWRSFIPDLVVAAKTSETICENCMAILKVTFTYSFSLFLVSYLLFTYGYEKNLKDLKTHISKLCQCLLMSATSSSDDVESMKKFYLHNPYILTLREVGDGKDETIPKNVQQFSVRVVTSQNYQS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G087120`
TK1151 ID	TkA03G087120
OH-1004 ID	LXL04_026616
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	83.300
Protein coverage (%)	TK1151 98.077 / OH-1004 46.707 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G087120

Location Chr03:22210097-22211295 (+)

Description Similar to XPO1: Protein EXPORTIN 1A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17020`	Receptor for the leucine-rich nuclear export signal (NES).	Nuclear export of proteins in plants: AtXPO1 is the export receptor for leucine-rich nuclear export signals in Arabidopsis thaliana.1999 · DOI: 10.1046/j.1365-313x.1999.00644.x Exportin1 genes are essential for development and function of the gametophytes in Arabidopsis thaliana.2008 · DOI: 10.1534/genetics.108.094896 Isolation and characterization of the Arabidopsis heat-intolerant 2 (hit2) mutant reveal the essential role of the nuclear export receptor EXPORTIN1A (XPO1A) in plant heat tolerance.2010 · DOI: 10.1111/j.1469-8137.2010.03225.x
`At3g03110`	Receptor for the leucine-rich nuclear export signal (NES).	Exportin1 genes are essential for development and function of the gametophytes in Arabidopsis thaliana.2008 · DOI: 10.1534/genetics.108.094896
`At4g34910`	DEAD-box ATP-dependent RNA helicase 16.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0728800`	DEAD-box ATP-dependent RNA helicase 16.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026616 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000054 ribosomal subunit export from nucleus Biological Process

GO:0000055 ribosomal large subunit export from nucleus Biological Process

GO:0000056 ribosomal small subunit export from nucleus Biological Process

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006406 mRNA export from nucleus Biological Process

GO:0006611 protein export from nucleus Biological Process

GO:0006913 nucleocytoplasmic transport Biological Process

GO:0009408 response to heat Biological Process

GO:0009410 response to xenobiotic stimulus Biological Process

GO:0009553 embryo sac development Biological Process

GO:0009555 pollen development Biological Process

GO:0009846 pollen germination Biological Process

KEGG gene cross-reference

ath:AT3G03110

ath:AT5G17020

hsa:7514

mmu:103573

rno:85252

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.473

Rank 1 · TkA03G087120 · TK1151

Cytoplasm0.445

Rank 2 · TkA03G087120 · TK1151

Endoplasmic reticulum0.077

Rank 3 · TkA03G087120 · TK1151

Mitochondrion0.077

Rank 4 · TkA03G087120 · TK1151

Golgi apparatus0.076

Rank 5 · TkA03G087120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08389Xpo112-62 aa

PF12940RAG182-98 aa

PF18268Hit1_C86-137 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G087120	`PF08389`	Xpo1	12	62	2.4e-13	51.1
TkA03G087120	`PF12940`	RAG1	82	98	0.32	12.0
TkA03G087120	`PF18268`	Hit1_C	86	137	0.11	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SMV6`	Arabidopsis thaliana	sp\|Q9SMV6\|XPO1A_ARATH Protein EXPORTIN 1A	85.000%	Swiss-Prot	Low
`F4IZR5`	Arabidopsis thaliana	sp\|F4IZR5\|XPO1B_ARATH Protein EXPORTIN 1B	83.300%	Swiss-Prot	Low
`Q9SW44`	Arabidopsis thaliana	sp\|Q9SW44\|RH16_ARATH DEAD-box ATP-dependent RNA helicase 16	60.000%	Swiss-Prot	Low
`Q6ATJ8`	Oryza sativa subsp. japonica	sp\|Q6ATJ8\|RH16_ORYSJ DEAD-box ATP-dependent RNA helicase 16	58.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card