TkA03G084970 | RubberDandelionOmics

Gene overview

TkA03G084970

Reference: TK1151 Chr: Chr03 Coordinates: 21627618-21633410 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

630 bp · TkA03G084970|TK1151|cDNA

ATGAAGAGCGTCGTAAAAATTATACTACATATCTCACTCCTCTTTACTTTCCAAGATCTCCATAACCAGTCCTCCTTCAACAAATCCTATCCTGTCACATATCCAAATCAGTACACACTCTATTTCTCCAACTGCAACCCCTTATCCCATGTGACAATATTGGATGTCCGTACAGAGCTATACAACATGGATAACAATGGCACTACCAAAAACTATCTATCAGCCGGAATGACAAAGCTCCCGGGTCTTTATTTCAATGT...

CDS

Download CDS FASTA

630 bp · TkA03G084970|TK1151|CDS

ATGAAGAGCGTCGTAAAAATTATACTACATATCTCACTCCTCTTTACTTTCCAAGATCTCCATAACCAGTCCTCCTTCAACAAATCCTATCCTGTCACATATCCAAATCAGTACACACTCTATTTCTCCAACTGCAACCCCTTATCCCATGTGACAATATTGGATGTCCGTACAGAGCTATACAACATGGATAACAATGGCACTACCAAAAACTATCTATCAGCCGGAATGACAAAGCTCCCGGGTCTTTATTTCAATGT...

Protein

Download Protein FASTA

209 aa · TkA03G084970|TK1151|PROTEIN

MKSVVKIILHISLLFTFQDLHNQSSFNKSYPVTYPNQYTLYFSNCNPLSHVTILDVRTELYNMDNNGTTKNYLSAGMTKLPGLYFNVSIIYLCFLWVWIFECFINSKCCHVLHFLMGVLLVVKAINLFFAAEVQKSMMITGTRWDVLFYVFQFFTQALLYTVIAIIYDRKMTLIYVIPLQFLAGILSKLAEPAGADVGFPGFLLVMHYK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G084970`
TK1151 ID	TkA03G084970
OH-1004 ID	LXL04_004912
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	56.500
Protein coverage (%)	TK1151 88.038 / OH-1004 45.205 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G084970

Location Chr03:21627618-21633410 (-)

Description Similar to CAND7: Protein CANDIDATE G-PROTEIN COUPLED RECEPTOR 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g18520`	Plays a role in plants and microbes interactions.	Two G-protein-coupled-receptor candidates, Cand2 and Cand7, are involved in Arabidopsis root growth mediated by the bacterial quorum-sensing signals N-acyl-homoserine lactones.2012 · DOI: 10.1016/j.bbrc.2011.12.066
`At5g02630`	G protein-coupled receptor.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004912 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0007186 G protein-coupled receptor signaling pathway Biological Process

GO:0010015 root morphogenesis Biological Process

GO:0034122 negative regulation of toll-like receptor signaling pathway Biological Process

GO:0050776 regulation of immune response Biological Process

GO:0072583 clathrin-dependent endocytosis Biological Process

GO:0072659 protein localization to plasma membrane Biological Process

GO:2001008 positive regulation of cellulose biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005769 early endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

KEGG gene cross-reference

ath:AT5G02630

ath:AT5G18520

hsa:56927

mmu:277463

rno:311857

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.389

Rank 1 · TkA03G084970 · TK1151

Golgi apparatus0.292

Rank 2 · TkA03G084970 · TK1151

Lysosome / Vacuole0.180

Rank 3 · TkA03G084970 · TK1151

Cytoplasm0.177

Rank 4 · TkA03G084970 · TK1151

Cell membrane0.113

Rank 5 · TkA03G084970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21904CAND6-7_N10-62 aa

PF00420Oxidored_q2110-172 aa

PF21904CAND6-7_N120-138 aa

PF10166DUF2368132-184 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G084970	`PF21904`	CAND6-7_N	10	62	6.8e-15	56.2
TkA03G084970	`PF00420`	Oxidored_q2	110	172	0.18	12.3
TkA03G084970	`PF21904`	CAND6-7_N	120	138	6.8e-15	56.2
TkA03G084970	`PF10166`	DUF2368	132	184	0.2	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JY11`	Arabidopsis thaliana	sp\|F4JY11\|CAND7_ARATH Protein CANDIDATE G PROTEIN-COUPLED RECEPTOR 7	45.300%	Swiss-Prot	Medium
`Q9LZ39`	Arabidopsis thaliana	sp\|Q9LZ39\|CAND6_ARATH Protein CANDIDATE G PROTEIN-COUPLED RECEPTOR 6	38.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card