TkA03G032810 | RubberDandelionOmics

Gene overview

TkA03G032810

Reference: TK1151 Chr: Chr03 Coordinates: 8735415-8741981 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2218 bp · TkA03G032810|TK1151|cDNA

TTTTAAAAGAAACTTGCAACGGTGCCTTTATATAGAGGCATTGAGAGAAATCTGTGTCTGGATTCTCTAGGAGCAACCAACGCAGGAGCTACAAACAGATCTGCTCGTCGACGTAGTCATTTCCTGCACTACGTTATGCTTATTCAGTGACAACTAAATATCAAAATGCTGATCACAACTATCAAGGATAGCTGCATATTTTTGGATGTGCTTCTTACTATCAAAGCCCTAAAAGTAGATGTAGTATTGGAAATGGAATT...

CDS

Download CDS FASTA

705 bp · TkA03G032810|TK1151|CDS

ATGATGGGATCCACAAATTATCGAGCTCGTGACGTGCACGTGACAGATAAGATAAGAATGAGGGAAGAAAATTCAGGTGGGCATTTGGCGATGGGGGAACGGGAAACAATCAGCGATTACGATTCGATGTCAACCCTCGCAACTAGAATTTGCAATCAAATAAACTCTGTTTTCGCTGAATCCTCCACCGCTACTTCTTCTCCCTTGGATATTACCGTCGACGAAATATCTTCCGCCGCCGCCCGCGGTGGAAAGGTCTT...

Protein

Download Protein FASTA

234 aa · TkA03G032810|TK1151|PROTEIN

MMGSTNYRARDVHVTDKIRMREENSGGHLAMGERETISDYDSMSTLATRICNQINSVFAESSTATSSPLDITVDEISSAAARGGKVFVYGVGREGLMMKALCMRLAHLGLSAHCVGDMTTPPISSSDLLIASAGPGGFSTVDAICGVAKTNGARVLVLTAQPESGSSVKYASVVAYIAAQTMADDGVETRPLLLPMGSVYEGAMFVLFEMVVFKLASVLGQSPHQIRSRHTNLE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G032810`
TK1151 ID	TkA03G032810
OH-1004 ID	LXL04_011880
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.500
Protein coverage (%)	TK1151 85.043 / OH-1004 74.532 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G032810`
Location	Chr03:8735415-8741981 (+)
Description	Similar to rmpB: 3-hexulose-6-phosphate isomerase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_011880` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009636 response to toxic substance Biological Process GO:0019647 formaldehyde assimilation via ribulose monophosphate cycle Biological Process GO:1901135 carbohydrate derivative metabolic process Biological Process GO:0016853 isomerase activity Molecular Function GO:0043800 6-phospho-3-hexuloisomerase activity Molecular Function GO:0097367 carbohydrate derivative binding Molecular Function
KEGG gene cross-reference	afu:AF_1796 ape:APE_1940.1 bsu:BSU03450 mth:MTH_249 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.701

Rank 1 · TkA03G032810 · TK1151

Nucleus0.416

Rank 2 · TkA03G032810 · TK1151

Mitochondrion0.072

Rank 3 · TkA03G032810 · TK1151

Peroxisome0.057

Rank 4 · TkA03G032810 · TK1151

Plastid0.050

Rank 5 · TkA03G032810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02776TPP_enzyme_N18-33 aa

PF13580SIS_252-106 aa

PF00782DSPc55-110 aa

PF01380SIS85-178 aa

PF13580SIS_2123-159 aa

PF02776TPP_enzyme_N130-168 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G032810	`PF02776`	TPP_enzyme_N	18	33	0.18	12.3
TkA03G032810	`PF13580`	SIS_2	52	106	0.052	14.3
TkA03G032810	`PF00782`	DSPc	55	110	0.3	11.6
TkA03G032810	`PF01380`	SIS	85	178	0.0082	16.7
TkA03G032810	`PF13580`	SIS_2	123	159	0.052	14.3
TkA03G032810	`PF02776`	TPP_enzyme_N	130	168	0.18	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card