TkA03G030130 | RubberDandelionOmics

Gene overview

TkA03G030130

Reference: TK1151 Chr: Chr03 Coordinates: 8077849-8080293 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1672 bp · TkA03G030130|TK1151|cDNA

AAGCAATTCTTTCAAATCTAGACATCCATCTACCCATGTGTTCCATCTTGACAAACCATTTAAGCCAGATGCTTCTGTTGGCCTTGAAGACTTCCGCTGCATGGGTTCCTTTAAATTTAATTGCAACCTGCATACCTCCCAGGTATTTGGACTCCATCGCGTTGTAGCCCTCCAGTTCGAACAGGGAGGGGAAGCTGCAAAGAGTATCGAAATCCTTAGCTTCACCTATCAACACTCCTTTTGTTGCCCACTCCTGAATC...

CDS

Download CDS FASTA

882 bp · TkA03G030130|TK1151|CDS

ATGGAATCATGCCTAGAGTTTCTAGAAGCCGTCCCATGGGTAGGCGAGGAAGAAGAAGACCGAGTTGTATCCTCCATTCTCCACCTCAAACACGAGTCAACGGGAGTCAACCCAATCCTCAAACGCGTATCATCGGACGCATCAAAACCCCAAAAAGACACCCTGTCCCACGTCCTCCACCTCGTCCTCAAAAGCACTGAGGAAAAAGGCCGCCGCGAAATGAAAACAGTCGTCTCAAAACTCCTCAAAGAAAACAACAA...

Protein

Download Protein FASTA

293 aa · TkA03G030130|TK1151|PROTEIN

MESCLEFLEAVPWVGEEEEDRVVSSILHLKHESTGVNPILKRVSSDASKPQKDTLSHVLHLVLKSTEEKGRREMKTVVSKLLKENNKSTPTVDLHDTIYTACKASLTSLLTLFRQLASPEFGSQPPDIKDPAVRQMVLESDNLSWLLDILADRNSADEFAVMWAGQQELAGLHGKVPLVNRYHISCITARLFVGVGRGEILPCKDTRHLLLKTWLQPLIDDYRWLQHGCKSFDRKVVEEGIGRTILTLPLEDQQIILLGW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G030130`
TK1151 ID	TkA03G030130
OH-1004 ID	LXL04_006381
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 56.346 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G030130

Location Chr03:8077849-8080293 (-)

Description Similar to At3g50780: BTB/POZ domain-containing protein At3g50780

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50780`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At1g63850`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At5g60050`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At2g13690`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006381 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G63850

ath:AT2G13690

ath:AT3G05675

ath:AT3G50780

ath:AT5G60050

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.484

Rank 1 · TkA03G030130 · TK1151

Cytoplasm0.435

Rank 2 · TkA03G030130 · TK1151

Mitochondrion0.082

Rank 3 · TkA03G030130 · TK1151

Golgi apparatus0.069

Rank 4 · TkA03G030130 · TK1151

Endoplasmic reticulum0.065

Rank 5 · TkA03G030130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25553BTB-POZ_ANK-like51-288 aa

PF27432YdfE_C106-130 aa

PF27432YdfE_C230-283 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G030130	`PF25553`	BTB-POZ_ANK-like	51	288	5e-58	197.1
TkA03G030130	`PF27432`	YdfE_C	106	130	0.058	14.6
TkA03G030130	`PF27432`	YdfE_C	230	283	0.058	14.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SVM0`	Arabidopsis thaliana	sp\|Q9SVM0\|Y3078_ARATH BTB/POZ domain-containing protein At3g50780	62.400%	Swiss-Prot	High
`Q9CAJ9`	Arabidopsis thaliana	sp\|Q9CAJ9\|Y1385_ARATH BTB/POZ domain-containing protein At1g63850	44.000%	Swiss-Prot	Medium
`Q9LVG9`	Arabidopsis thaliana	sp\|Q9LVG9\|Y5600_ARATH BTB/POZ domain-containing protein At5g60050	42.500%	Swiss-Prot	Medium
`Q9SKH2`	Arabidopsis thaliana	sp\|Q9SKH2\|Y2369_ARATH BTB/POZ domain-containing protein At2g13690	34.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card