RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G027990
Reference: TK1151 Chr: Chr03 Coordinates: 7512817-7515948 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

951 bp · TkA03G027990|TK1151|cDNA

ATGAGTTCTAATGTATCAGATTCGAACACTCTTTCAGGGGCTATTTCAACAACACATAAGACAGTTCTCACCACAAAATCCACACATATTCAAAAGGAAAATTTCAAGAAGCTTTCATCTTACTTGGAGAAAACAACATACATTCTACAAGAATTAACAAAGTTTGAGATCAATGATTCCGGGAGCTTAAAAACCAACAGGAACATAATTGACCTCTTGCTCAATTCTAGAAAAATCGTTAAGAGCTTAGAAAATGTCAC...

CDS

Download CDS FASTA

951 bp · TkA03G027990|TK1151|CDS

ATGAGTTCTAATGTATCAGATTCGAACACTCTTTCAGGGGCTATTTCAACAACACATAAGACAGTTCTCACCACAAAATCCACACATATTCAAAAGGAAAATTTCAAGAAGCTTTCATCTTACTTGGAGAAAACAACATACATTCTACAAGAATTAACAAAGTTTGAGATCAATGATTCCGGGAGCTTAAAAACCAACAGGAACATAATTGACCTCTTGCTCAATTCTAGAAAAATCGTTAAGAGCTTAGAAAATGTCAC...

Protein

Download Protein FASTA

316 aa · TkA03G027990|TK1151|PROTEIN

MSSNVSDSNTLSGAISTTHKTVLTTKSTHIQKENFKKLSSYLEKTTYILQELTKFEINDSGSLKTNRNIIDLLLNSRKIVKSLENVTKEIGSDINLLPNLIPFNGLSQDITKLSNIMTDAKYQETLREDEIKEKIELRIRERNVDRAFANNLLVSIADVIGISTDQSVLRQEYEDFKNEMETVWPVEDVAEVIWAHGPVHGPNLVLSINTKLGSLCQVVVLGHLILRIIFLPLRGDRSSAFRTLVQSYNRYLTRSALVWD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G027990
TK1151 IDTkA03G027990
OH-1004 IDLXL04_035375
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)70.300
Protein coverage (%)TK1151 98.101 / OH-1004 30.030
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G027990
LocationChr03:7512817-7515948 (+)
DescriptionSimilar to PUB44: U-box domain-containing protein 44
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g21350 Functions as an E3 ubiquitin ligase (By similarity).
A cryptic modifier causing transient self-incompatibility in Arabidopsis thaliana.2007 · DOI: 10.1016/j.cub.2007.03.022
At1g60190 Functions as an E3 ubiquitin ligase. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
UniProt: A2ZLU6 Defense related protein that negatively regulates programmed cell death. No verified direct reference in this release
Os12g0570000 E3 ubiquitin-protein ligase that negatively regulates programmed cell death and disease resistance.
Spotted leaf11, a negative regulator of plant cell death and defense, encodes a U-box/armadillo repeat protein endowed with E3 ubiquitin ligase activity.2004 · DOI: 10.1105/tpc.104.025171
SPIN1, a K homology domain protein negatively regulated and ubiquitinated by the E3 ubiquitin ligase SPL11, is involved in flowering time control in rice.2008 · DOI: 10.1105/tpc.108.058610
Os06g0102700 Possesses E3 ubiquitin-protein ligase in vitro. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_035375 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006970 response to osmotic stress Biological Process
GO:0009742 brassinosteroid mediated signaling pathway Biological Process
GO:0010115 regulation of abscisic acid biosynthetic process Biological Process
GO:0010150 leaf senescence Biological Process
GO:0010271 regulation of chlorophyll catabolic process Biological Process
GO:0010380 regulation of chlorophyll biosynthetic process Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0090359 negative regulation of abscisic acid biosynthetic process Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0005829 cytosol Cellular Component
KEGG gene cross-reference
ath:AT1G20780
ath:AT1G76390
dosa:Os03g0657100
dosa:Os06g0102700
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.365
Rank 1 · TkA03G027990 · TK1151
Nucleus0.324
Rank 2 · TkA03G027990 · TK1151
Cell membrane0.167
Rank 3 · TkA03G027990 · TK1151
Mitochondrion0.117
Rank 4 · TkA03G027990 · TK1151
Endoplasmic reticulum0.111
Rank 5 · TkA03G027990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04564U-box124-136 aa
PF04564U-box263-312 aa
PF11789zf-Nse263-302 aa
PF13923zf-C3HC4_2264-302 aa
PF13445zf-RING_UBOX265-301 aa
PF00097zf-C3HC4265-301 aa
PF13639zf-RING_2273-302 aa
PF12678zf-rbx1279-302 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G027990PF04564U-box1241366.4e-1452.6
TkA03G027990PF04564U-box2633126.4e-1452.6
TkA03G027990PF11789zf-Nse2633028e-0626.3
TkA03G027990PF13923zf-C3HC4_22643020.0002821.3
TkA03G027990PF13445zf-RING_UBOX2653010.000122.9
TkA03G027990PF00097zf-C3HC42653010.113.2
TkA03G027990PF13639zf-RING_22733020.3112.0
TkA03G027990PF12678zf-rbx12793020.008317.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O81902Arabidopsis thalianasp|O81902|PUB8_ARATH U-box domain-containing protein 853.300%Swiss-ProtLow
O80742Arabidopsis thalianasp|O80742|PUB19_ARATH U-box domain-containing protein 1945.900%Swiss-ProtLow
A2ZLU6Oryza sativa subsp. indicasp|A2ZLU6|SL11_ORYSI Protein spotted leaf 1145.100%Swiss-ProtLow
Q0IMG9Oryza sativa subsp. japonicasp|Q0IMG9|SL11_ORYSJ E3 ubiquitin-protein ligase SPL1145.100%Swiss-ProtLow
Q5VRH9Oryza sativa subsp. japonicasp|Q5VRH9|PUB12_ORYSJ U-box domain-containing protein 1244.100%Swiss-ProtLow

JBrowse

View in Genome Browser