TkA03G026590 | RubberDandelionOmics

Gene overview

TkA03G026590

Reference: TK1151 Chr: Chr03 Coordinates: 7110149-7112471 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1004 bp · TkA03G026590|TK1151|cDNA

TTATAACCATACACACTTCCATATTTAGCTTAAACGACGCCATTGCCAGTACAAGTTCGGTAATCGGTCGTTATTTCTAGAACAACGGAAACAGAGAACACAAAAAACCAGAAACCAAGTGATCCGAGTTTGCAGAGAGAGCTCTCCACTCTCACTCTAAAATTCCCACAATCTTTCTAGGGTTCTTCTTTCTGTTTTCCCCAAAAACAAAAATGTGGAGATCGACAACTATACTAACGACCGTTGTCGTAATATTAGGG...

CDS

Download CDS FASTA

648 bp · TkA03G026590|TK1151|CDS

ATGTGGAGATCGACAACTATACTAACGACCGTTGTCGTAATATTAGGGCTTGTTTCATCACCTGTGGTGAAGGGAATGAGGTTCGAGATCAAAACCGGAGCCACAAAATGCATAACGGAAGATATTCCGTCGAATTCGCTGACTGTCGGAAAATACAGCATCGTCGATCCGAAAGAAGATCATCCGTTGCCTGATAGCCATCGTATCACCGTCAGAATAACCTCACCACTTGGGAATAACTGTCACTATGCGGATCAAAA...

Protein

Download Protein FASTA

215 aa · TkA03G026590|TK1151|PROTEIN

MWRSTTILTTVVVILGLVSSPVVKGMRFEIKTGATKCITEDIPSNSLTVGKYSIVDPKEDHPLPDSHRITVRITSPLGNNCHYADQKDHGEFAYTAHEDGDYMACFWVAKQNPQTTLTIEFDWRYGLAAKDWSNVAKRGQLEMMELDLKKLFDTIAIIHDEMFYLREREESMQLLIRSTNSKMATFSFFSLIVCLAVACMQLWHLKTFFERKKLI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G026590`
TK1151 ID	TkA03G026590
OH-1004 ID	LXL04_006319
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G026590

Location Chr03:7110149-7112471 (+)

Description Similar to At1g26690: Transmembrane emp24 domain-containing protein p24delta9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g14010`	Involved in vesicular protein trafficking.	No verified direct reference in this release
`At1g26690`	Involved in vesicular protein trafficking.	No verified direct reference in this release
`At2g03290`	Involved in vesicular protein trafficking.	No verified direct reference in this release
`At1g69460`	Involved in vesicular protein trafficking.	No verified direct reference in this release
`At3g29070`	Involved in vesicular protein trafficking.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006319 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0007030 Golgi organization Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005793 endoplasmic reticulum-Golgi intermediate compartment Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0030134 COPII-coated ER to Golgi transport vesicle Cellular Component

GO:0032580 Golgi cisterna membrane Cellular Component

KEGG gene cross-reference

ath:AT1G14010

ath:AT1G26690

ath:AT1G69460

ath:AT2G03290

ath:AT3G29070

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.625

Rank 1 · TkA03G026590 · TK1151

Golgi apparatus0.474

Rank 2 · TkA03G026590 · TK1151

Cytoplasm0.097

Rank 3 · TkA03G026590 · TK1151

Cell membrane0.053

Rank 4 · TkA03G026590 · TK1151

Nucleus0.045

Rank 5 · TkA03G026590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01105EMP24_GP25L26-210 aa

PF27908Lept_O_ant_chp183-150 aa

PF10990DUF2809182-207 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G026590	`PF01105`	EMP24_GP25L	26	210	2e-47	162.3
TkA03G026590	`PF27908`	Lept_O_ant_chp1	83	150	0.03	14.3
TkA03G026590	`PF10990`	DUF2809	182	207	0.2	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GYG1`	Arabidopsis thaliana	sp\|Q8GYG1\|P24D7_ARATH Transmembrane emp24 domain-containing protein p24delta7	55.800%	Swiss-Prot	High
`Q9LQY3`	Arabidopsis thaliana	sp\|Q9LQY3\|P24D9_ARATH Transmembrane emp24 domain-containing protein p24delta9	58.100%	Swiss-Prot	High
`O81045`	Arabidopsis thaliana	sp\|O81045\|P24D8_ARATH Transmembrane emp24 domain-containing protein p24delta8	57.400%	Swiss-Prot	High
`Q8VY92`	Arabidopsis thaliana	sp\|Q8VY92\|P24DA_ARATH Transmembrane emp24 domain-containing protein p24delta10	54.100%	Swiss-Prot	High
`Q9LJV9`	Arabidopsis thaliana	sp\|Q9LJV9\|P24DB_ARATH Transmembrane emp24 domain-containing protein p24delta11	49.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card