TkA03G026180 | RubberDandelionOmics

Gene overview

TkA03G026180

Reference: TK1151 Chr: Chr03 Coordinates: 7010363-7013009 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

993 bp · TkA03G026180|TK1151|cDNA

AAAAATACATTCTTCCTTCTTCGCTCGAACAAAGAAGACCCATCGAATTATTCAAAGTATCCATCCAAGTCGCCGGTAAACAAATTCAATATTAGATCCACTGCCTGAATCCACCTGATTTTCCGATCACTTTATCTGTCAGTTCTCCGTCAAGTGTAAGTTTCGATTAAGGATTTGCTGCGAACGAGATGAGTGAGGTATTTGAAGGTTACGAACGCCAATACTGCGAGCTATCGGCTGGATTGTCGAAGAAGTGTACA...

CDS

Download CDS FASTA

666 bp · TkA03G026180|TK1151|CDS

ATGAGTGAGGTATTTGAAGGTTACGAACGCCAATACTGCGAGCTATCGGCTGGATTGTCGAAGAAGTGTACATCGGCTAGTCTTCTAGATGGAGAGCAAAAGAAGCAGAAACTTTCTGAAATAACAGCTGGACTTGATCAAGCTGAAGCTCTGATACGCAAAATGGACCTTGAGGCAAGAAGCTTACAGCCAAATGTGAAGGCTGTGCTTCTTGCTAAGCTAAGGGAATACAAATCTGATCTAAATAATTTGAAAAGTGA...

Protein

Download Protein FASTA

221 aa · TkA03G026180|TK1151|PROTEIN

MSEVFEGYERQYCELSAGLSKKCTSASLLDGEQKKQKLSEITAGLDQAEALIRKMDLEARSLQPNVKAVLLAKLREYKSDLNNLKSEVKRIASNSLNQAARDELLESGMADAATVSADQKGRLLMSTERLNKTSDRVRDSRRTMLETEELGVSILQDLNQQRQSLLHAHGNLHGVDDNLGKSKKILTNMSRRMSRNKYIIGSIVAVLILAIILILYFKLKK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G026180`
TK1151 ID	TkA03G026180
OH-1004 ID	LXL04_006323
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G026180

Location Chr03:7010363-7013009 (+)

Description Similar to VTI13: Vesicle transport v-SNARE 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g39510`	Functions as a v-SNARE responsible for targeting AtELP-containing vesicles from the trans-Golgi network (TGN) to the prevacuolar compartment (PVC) and mediates liposome fusion.	The plant vesicle-associated SNARE AtVTI1a likely mediates vesicle transport from the trans-Golgi network to the prevacuolar compartment.1999 · DOI: 10.1091/mbc.10.7.2251 SGR2, a phospholipase-like protein, and ZIG/SGR4, a SNARE, are involved in the shoot gravitropism of Arabidopsis.2002 · DOI: 10.1105/tpc.010215 Involvement of the vacuoles of the endodermis in the early process of shoot gravitropism in Arabidopsis.2002 · DOI: 10.1105/tpc.010216 Conversion of functional specificity in Qb-SNARE VTI1 homologues of Arabidopsis.2005 · DOI: 10.1016/j.cub.2005.02.021 Divergent functions of VTI12 and VTI11 in trafficking to storage and lytic vacuoles in Arabidopsis.2007 · DOI: 10.1073/pnas.0611147104 The occurrence of 'bulbs', a complex configuration of the vacuolar membrane, is affected by mutations of vacuolar SNARE and phospholipase in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2011.04665.x Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22 Mutations in the SGR4, SGR5 and SGR6 loci of Arabidopsis thaliana alter the shoot gravitropism.1997 · DOI: 10.1093/oxfordjournals.pcp.a029201
`At3g29100`	May function as a v-SNARE responsible for targeting vesicles involved in the secretory pathway (By similarity).	SNARE VTI13 plays a unique role in endosomal trafficking pathways associated with the vacuole and is essential for cell wall organization and root hair growth in arabidopsis.2014 · DOI: 10.1093/aob/mcu041
`At1g26670`	Together with either SYP41 or SYP61, required for membrane fusion; the fusion of phospholipid vesicles containing SYP41 or SYP61 and VTI12 is triggered by YKT61 and YKT62.	Conversion of functional specificity in Qb-SNARE VTI1 homologues of Arabidopsis.2005 · DOI: 10.1016/j.cub.2005.02.021 YKT6 is a core constituent of membrane fusion machineries at the Arabidopsis trans-Golgi network.2005 · DOI: 10.1016/j.jmb.2005.04.061 Divergent functions of VTI12 and VTI11 in trafficking to storage and lytic vacuoles in Arabidopsis.2007 · DOI: 10.1073/pnas.0611147104 Functional redundancy between trans-Golgi network SNARE family members in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2091-14-22

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006323 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006623 protein targeting to vacuole Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0006891 intra-Golgi vesicle-mediated transport Biological Process

GO:0006896 Golgi to vacuole transport Biological Process

GO:0006906 vesicle fusion Biological Process

GO:0006914 autophagy Biological Process

GO:0009630 gravitropism Biological Process

GO:0009664 plant-type cell wall organization Biological Process

GO:0016189 synaptic vesicle to endosome fusion Biological Process

GO:0016236 macroautophagy Biological Process

GO:0032456 endocytic recycling Biological Process

KEGG gene cross-reference

ath:AT1G26670

ath:AT3G29100

ath:AT5G39510

hsa:143187

mmu:53611

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.543

Rank 1 · TkA03G026180 · TK1151

Cytoplasm0.276

Rank 2 · TkA03G026180 · TK1151

Lysosome / Vacuole0.191

Rank 3 · TkA03G026180 · TK1151

Endoplasmic reticulum0.163

Rank 4 · TkA03G026180 · TK1151

Cell membrane0.094

Rank 5 · TkA03G026180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05008V-SNARE1-91 aa

PF31021RBSN_mid7-66 aa

PF03233Cauli_AT25-91 aa

PF30842LEKR130-90 aa

PF27021BOS1_GOSR2_MEM11-like_N31-106 aa

PF06810Phage_scaffold31-117 aa

PF02601Exonuc_VII_L32-162 aa

PF12352V-SNARE_C35-56 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G026180	`PF05008`	V-SNARE	1	91	1.4e-32	112.7
TkA03G026180	`PF31021`	RBSN_mid	7	66	3.9	8.9
TkA03G026180	`PF03233`	Cauli_AT	25	91	0.55	10.9
TkA03G026180	`PF30842`	LEKR1	30	90	3.5	8.7
TkA03G026180	`PF27021`	BOS1_GOSR2_MEM11-like_N	31	106	0.00082	20.3
TkA03G026180	`PF06810`	Phage_scaffold	31	117	0.094	13.4
TkA03G026180	`PF02601`	Exonuc_VII_L	32	162	0.47	10.6
TkA03G026180	`PF12352`	V-SNARE_C	35	56	2.1e-21	76.7
TkA03G026180	`PF20878`	REST_helical	35	67	0.73	10.8
TkA03G026180	`PF27150`	Rv2240c	49	101	0.26	12.5
TkA03G026180	`PF03908`	Sec20	58	58	1.4e-06	28.9
TkA03G026180	`PF20834`	Lem25	64	156	0.018	16.5
TkA03G026180	`PF02009`	RIFIN	64	216	0.022	15.4
TkA03G026180	`PF09716`	ETRAMP	70	70	0.045	14.5
TkA03G026180	`PF00523`	Fusion_gly	71	97	0.46	9.5
TkA03G026180	`PF31021`	RBSN_mid	72	143	3.9	8.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SEL6`	Arabidopsis thaliana	sp\|Q9SEL6\|VTI11_ARATH Vesicle transport v-SNARE 11	74.200%	Swiss-Prot	High
`Q9LVP9`	Arabidopsis thaliana	sp\|Q9LVP9\|VTI13_ARATH Vesicle transport v-SNARE 13	72.900%	Swiss-Prot	High
`Q9SEL5`	Arabidopsis thaliana	sp\|Q9SEL5\|VTI12_ARATH Vesicle transport v-SNARE 12	67.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card