TkA03G025910 | RubberDandelionOmics

Gene overview

TkA03G025910

Reference: TK1151 Chr: Chr03 Coordinates: 6933371-6934738 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1262 bp · TkA03G025910|TK1151|cDNA

AAATTATTGATCCTGTTTTTCATAATTGTCAAGAAAGAAAGAACGAAAGAAAGGCCCTATAGGCAATCGAACTCTTCAGCCCAAAGCTTCATCAGTGTGCGGCCATGGCGAAATGCTATTTTACTCGACGTGAACGTGTGTCACTCTCCTCTCTCTATTGAAACAGGGGCGGTGACCGATAAATTAATCGAGTTCATGACTCTTAGACGAGTCTCTTTTTGTCCTCTTTCATGCCTCTTCAAACCTCTCTTCAGCCGGCC...

CDS

Download CDS FASTA

648 bp · TkA03G025910|TK1151|CDS

ATGGTCTGTATCCATAGCTCAATTCCGGTTAGCCACCACATGAACATGGCTAATCAATCACAAAAATCATCAAAACGAACACCCATTTCAACATGTGAACAATCTCCATCAGCTTTGATTGATGTGATCATCTTAGTTGCTGTAATCGGTGCTTGCGGGTTCTTAATTTATCCCTATGTAAACCTTTTATTCTCCGGAACCCTTGAATTCCTCGAAGCAATTACGTTTGTGGTGAAAGACGAGGCTTTAGAAGCTCCGTT...

Protein

Download Protein FASTA

215 aa · TkA03G025910|TK1151|PROTEIN

MVCIHSSIPVSHHMNMANQSQKSSKRTPISTCEQSPSALIDVIILVAVIGACGFLIYPYVNLLFSGTLEFLEAITFVVKDEALEAPLIYGCLVLSIFGASMAVLAITLCTSSQKCGKPGCRGLHKPAEFDIQLETDNSLTNSSSSNGGSKLGEIGLKKGLFELRRDYHKELEAELKKMAPINGRAVLVFRARCGCSVGRMEVLGPKKNNTKKIKK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G025910`
TK1151 ID	TkA03G025910
OH-1004 ID	LXL04_006298
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 93.953 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G025910

Location Chr03:6933371-6934738 (-)

Description Similar to At5g19025: Uncharacterized protein At5g19025

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19025`	Uncharacterized protein At5g19025.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006298 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT5G19025

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.363

Rank 1 · TkA03G025910 · TK1151

Nucleus0.191

Rank 2 · TkA03G025910 · TK1151

Cytoplasm0.156

Rank 3 · TkA03G025910 · TK1151

Golgi apparatus0.153

Rank 4 · TkA03G025910 · TK1151

Mitochondrion0.145

Rank 5 · TkA03G025910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28759NDUFA334-60 aa

PF28125At5g19025_N40-111 aa

PF28759NDUFA382-108 aa

PF20586DUF6788106-126 aa

PF30682At5g19025_C128-201 aa

PF20586DUF6788169-195 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G025910	`PF28759`	NDUFA3	34	60	0.35	11.3
TkA03G025910	`PF28125`	At5g19025_N	40	111	1.6e-19	71.2
TkA03G025910	`PF28759`	NDUFA3	82	108	0.35	11.3
TkA03G025910	`PF20586`	DUF6788	106	126	0.18	12.5
TkA03G025910	`PF30682`	At5g19025_C	128	201	3.7e-16	59.3
TkA03G025910	`PF20586`	DUF6788	169	195	0.18	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0C8Q9`	Arabidopsis thaliana	sp\|P0C8Q9\|Y5902_ARATH Uncharacterized protein At5g19025	41.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card