TkA03G021090 | RubberDandelionOmics

Gene overview

TkA03G021090

Reference: TK1151 Chr: Chr03 Coordinates: 5441545-5446449 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2852 bp · TkA03G021090|TK1151|cDNA

CTCATTTCCTTTCTTTTCCCTCGATAAATTAAACTCGGGAACAAGGTCTCACGGCGCGGGTTACTGGTTAGGACTTAGGACCTCGTAAACATGGAGTGGGTTTTGCAATGGAGTTGCTCTAAGAAACCAGTCCCTCTGTAACCTTTTAGGGCAAACACGATTAACTAACGAGGAAGACGAAGCTGCAAACACATTTCATAACCATTACCCGACCACCATTCGCCGTCGGCAATGATTCCGACCACCAGGCGACCCAAAAC...

CDS

Download CDS FASTA

756 bp · TkA03G021090|TK1151|CDS

ATGGATGTTTTTCATCAAAGGCTTGAACAAGAGTATGGAACTCATATAATTTCTACAGTTCCAACTGTACCATATATATTCGAGTATTCAGATGGCACCAAAGTAGAGGTTCAAAATCCAGGTGCCTTTACTGCAAACCCTAAAATCCGAGTAGTAGCATCATGGGAACCTACAGTATTAGCAACAATTATTATCCCCAGTGAGTATGTTGGAGCTGTTATTACTCTTTGTTCTGAAAGAAGAGGGGAACAACTAGAGTA...

Protein

Download Protein FASTA

251 aa · TkA03G021090|TK1151|PROTEIN

MDVFHQRLEQEYGTHIISTVPTVPYIFEYSDGTKVEVQNPGAFTANPKIRVVASWEPTVLATIIIPSEYVGAVITLCSERRGEQLEYSFIDSQRAFMKYRLPLREIVVDFYNELKSITSGYASFDYEDSEYVASDVVKLDVLLNGQPVDAMATIVHSLKAQRVGRELVDKLKKFIDRQMFEITIQAAVGSKVIARETISAMRKNVLAKCYGGDVTRKKKLLEKQKEGKKRMKRVGSVDIPQEAFHAILKVG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G021090`
TK1151 ID	TkA03G021090
OH-1004 ID	LXL04_037667
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	68.500
Protein coverage (%)	TK1151 20.717 / OH-1004 13.953 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G021090

Location Chr03:5441545-5446449 (-)

Description Similar to Sb10g003070: Translation factor GUF1 homolog, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g39900`	Promotes mitochondrial protein synthesis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0144800`	Promotes mitochondrial protein synthesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037667 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0045727 positive regulation of translation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003924 GTPase activity Molecular Function

GO:0005525 GTP binding Molecular Function

GO:0043022 ribosome binding Molecular Function

GO:0097177 mitochondrial ribosome binding Molecular Function

KEGG gene cross-reference

ath:AT5G39900

dosa:Os06g0144800

rcu:8276038

sbi:8068764

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.862

Rank 1 · TkA03G021090 · TK1151

Nucleus0.232

Rank 2 · TkA03G021090 · TK1151

Endoplasmic reticulum0.068

Rank 3 · TkA03G021090 · TK1151

Cell membrane0.042

Rank 4 · TkA03G021090 · TK1151

Lysosome / Vacuole0.028

Rank 5 · TkA03G021090 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00679EFG_C56-139 aa

PF03170CBM_BcsB_1st116-152 aa

PF29699NOP1_C122-168 aa

PF06421LepA_C143-249 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G021090	`PF00679`	EFG_C	56	139	6.1e-23	81.4
TkA03G021090	`PF03170`	CBM_BcsB_1st	116	152	0.038	14.4
TkA03G021090	`PF29699`	NOP1_C	122	168	0.15	12.2
TkA03G021090	`PF06421`	LepA_C	143	249	2.8e-50	169.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLE4`	Arabidopsis thaliana	sp\|Q9FLE4\|GUF1_ARATH Translation factor GUF1 homolog, mitochondrial	81.200%	Swiss-Prot	High
`Q5VQ69`	Oryza sativa subsp. japonica	sp\|Q5VQ69\|GUF1_ORYSJ Translation factor GUF1 homolog, mitochondrial	84.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card