Gene Card
Gene overview
cDNA / CDS / Protein Sequences
354 bp · TkA03G015490|TK1151|cDNA
ATGTCTACTTCACGAGAATCTACAATGTCTTCCCAATATCGGTCGACTGGCACATCAAACAAGAGTGGTGTATGCAAAGGATGGAAGGCTACCTTCAGCAGGTGTTACTGTGGAGAAGGAGCACATTGTTCAGTATCATGGAGTGACAAAAACCCTGCAAGAAGATACCATGGATGCAAGTATTGGCCTGATGAAAAGGAGGATAGTGGGTACTTTGACTGGTATGATGATGGACTAAGTGAATGGTACAATCAGGTGTT...
354 bp · TkA03G015490|TK1151|CDS
ATGTCTACTTCACGAGAATCTACAATGTCTTCCCAATATCGGTCGACTGGCACATCAAACAAGAGTGGTGTATGCAAAGGATGGAAGGCTACCTTCAGCAGGTGTTACTGTGGAGAAGGAGCACATTGTTCAGTATCATGGAGTGACAAAAACCCTGCAAGAAGATACCATGGATGCAAGTATTGGCCTGATGAAAAGGAGGATAGTGGGTACTTTGACTGGTATGATGATGGACTAAGTGAATGGTACAATCAGGTGTT...
Protein
Download Protein FASTA117 aa · TkA03G015490|TK1151|PROTEIN
MSTSRESTMSSQYRSTGTSNKSGVCKGWKATFSRCYCGEGAHCSVSWSDKNPARRYHGCKYWPDEKEDSGYFDWYDDGLSEWYNQVLNEMKPKKKPGIPEFVNPRLIFLVKHFLASS
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G015490 |
|---|---|
| TK1151 ID | TkA03G015490 |
| OH-1004 ID | LXL04_029984 |
| Relationship / confidence | Multi Candidate From Tk1151 / Complex relationship |
| Protein identity (%) | 85.600 |
| Protein coverage (%) | TK1151 94.872 / OH-1004 16.276Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G015490 |
|---|---|
| Location | Chr03:3990560-3990913 (+) |
| Description | Similar to STY46: Serine/threonine-protein kinase STY46 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006468 protein phosphorylation Biological Process GO:0007165 signal transduction Biological Process GO:0009658 chloroplast organization Biological Process GO:0009737 response to abscisic acid Biological Process GO:0010119 regulation of stomatal movement Biological Process GO:0010344 seed oilbody biogenesis Biological Process GO:0045995 regulation of embryonic development Biological Process GO:0046777 protein autophosphorylation Biological Process GO:0071244 cellular response to carbon dioxide Biological Process GO:0071456 cellular response to hypoxia Biological Process GO:0090333 regulation of stomatal closure Biological Process GO:2000030 regulation of response to red or far red light Biological Process |
| KEGG gene cross-reference | ath:AT1G62400 ath:AT2G17700 ath:AT2G24360 ath:AT4G35780 ath:AT4G38470 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF21479DIKK1-2-4_C-subdom232-60 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G015490 | PF21479 | DIKK1-2-4_C-subdom2 | 32 | 60 | 0.00042 | 21.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.