TkA03G013380 | RubberDandelionOmics

Gene overview

TkA03G013380

Reference: TK1151 Chr: Chr03 Coordinates: 3468297-3480528 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2284 bp · TkA03G013380|TK1151|cDNA

ATCGGTTGTATTCAGTAGTCATTGTTTGTTGTCTCCCCAATTGATCGCCAAATGTCACCTGAAGCAATTTCAGGCCGTCGATGCAAGAAACGGGAGTGTTGCCCCCATCGTTTCTCTCCAGATTTAGGTCAAAGTTACTGATAAAGTAACAACTATGCCCGGCAACACCCAATTCTTGATAAAGCTACTGATAACAAATTGTTGTCTCCCCAATTGATCGCTTAATCGCTAAATGTCACCACAACATCCGCCGGCAACCT...

CDS

Download CDS FASTA

1023 bp · TkA03G013380|TK1151|CDS

ATGATGTCTGAAACTGCTCTTAGAGATCTTAATCTCCTGCCCAAATCCGAGAGAACTAATGAGAGCTCAAGTAAAGACATCTTAACTACAAAGCCATATGTTGAACCAATAAAAAACATTGGTTCTTTAGCTGAACCACCAAAGAAAGGAACCGAAGATGAACATGCTTGTGCTGACGTGGCAGTTGCAGAAGTTGAATACATCGAATCTGAGAAACTGGATGATCTGGAAGATTTTGAAAATAGTCTCAAGGTGCTTCT...

Protein

Download Protein FASTA

340 aa · TkA03G013380|TK1151|PROTEIN

MMSETALRDLNLLPKSERTNESSSKDILTTKPYVEPIKNIGSLAEPPKKGTEDEHACADVAVAEVEYIESEKLDDLEDFENSLKVLLSGLESKDWVFQCETLNNVRRISIYHKEALQDILDNVITLVVKALKNPRSAVCKTAIMTSEDIFKAFGDHVIDSLDPMLVQLLLKSSQDKRFVCEAAEKALIALTIWVSPVLLLPKLQPYLKHRNPRIRAKASLSVSRCVPRLGAEGIKEYGIDKLIQIASSQLSDQLPESREA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G013380`
TK1151 ID	TkA03G013380
OH-1004 ID	LXL04_006160
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	94.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G013380`
Location	Chr03:3468297-3480528 (+)
Description	Similar to Togaram2: TOG array regulator of axonemal microtubules protein 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006160` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000226 microtubule cytoskeleton organization Biological Process GO:0031116 positive regulation of microtubule polymerization Biological Process GO:0035082 axoneme assembly Biological Process GO:0060271 cilium assembly Biological Process GO:1905515 non-motile cilium assembly Biological Process GO:0005881 cytoplasmic microtubule Cellular Component GO:0005929 cilium Cellular Component GO:0005930 axoneme Cellular Component GO:0036064 ciliary basal body Cellular Component GO:0008017 microtubule binding Molecular Function
KEGG gene cross-reference	hsa:165186 hsa:23116 mmu:320159 mmu:328108 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.680

Rank 1 · TkA03G013380 · TK1151

Nucleus0.319

Rank 2 · TkA03G013380 · TK1151

Cell membrane0.099

Rank 3 · TkA03G013380 · TK1151

Golgi apparatus0.098

Rank 4 · TkA03G013380 · TK1151

Mitochondrion0.073

Rank 5 · TkA03G013380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15703LAT232-85 aa

PF24714TOR1L1_N60-253 aa

PF01602Adaptin_N77-125 aa

PF23227HEAT_MROH2B_C80-191 aa

PF24987HEAT_EF3_N82-145 aa

PF02985HEAT84-108 aa

PF13646HEAT_285-167 aa

PF25782TPR_CAND191-162 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G013380	`PF15703`	LAT2	32	85	0.12	13.0
TkA03G013380	`PF24714`	TOR1L1_N	60	253	0.081	13.0
TkA03G013380	`PF01602`	Adaptin_N	77	125	0.0045	16.3
TkA03G013380	`PF23227`	HEAT_MROH2B_C	80	191	0.0015	18.7
TkA03G013380	`PF24987`	HEAT_EF3_N	82	145	0.0058	17.3
TkA03G013380	`PF02985`	HEAT	84	108	0.014	16.3
TkA03G013380	`PF13646`	HEAT_2	85	167	0.014	16.4
TkA03G013380	`PF25782`	TPR_CAND1	91	162	0.035	15.2
TkA03G013380	`PF13513`	HEAT_EZ	114	143	0.0063	17.8
TkA03G013380	`PF25574`	TPR_IMB1	114	169	0.029	13.8
TkA03G013380	`PF12717`	Cnd1	116	145	0.044	14.5
TkA03G013380	`PF12348`	CLASP_N	117	269	1.5e-06	28.6
TkA03G013380	`PF01602`	Adaptin_N	117	190	0.0045	16.3
TkA03G013380	`PF20926`	Htt_N-HEAT_1	118	181	0.17	12.9
TkA03G013380	`PF21041`	XMAP215_CLASP_TOG	121	205	0.0052	17.3
TkA03G013380	`PF02985`	HEAT	124	144	0.014	16.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card