TkA03G011210 | RubberDandelionOmics

Gene overview

TkA03G011210

Reference: TK1151 Chr: Chr03 Coordinates: 2885478-2888226 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2437 bp · TkA03G011210|TK1151|cDNA

CTGATTATCCTCTTCTTTTCCCCCAATTTCTTCGACTCAACATTTGATTTTTTTCAGTTTTAATCAAAGTTCCAAGAGGCAAACAAAAACCCCACCTCTTCGATAGCGATTAGCTCAAAAAAAATCACGATACAGCTTCTTTCATGGTCTAGAGATTCTGCTTTCCAACAGAAATGGAAGCCGTTGAAGGGAACAACATCATAACAACCGATACCTTAACTGGAGTTTCTGTTTCTTCACCTCATATACCCTCGAAACCC...

CDS

Download CDS FASTA

1470 bp · TkA03G011210|TK1151|CDS

ATGCTTTCGATTTCACAGAAGATGTTCACGAAAATTCAAATCTCCAAAATGGCGACAAAATCAATGAAACCCAAGAACAAGATCAATATCAAGAAGAATATGAATCGCATGATTATGTTGTGGGCGATTTCGTATGGGGGAAAATCAAGTCACATCCATGGTGGCCGGGTCAAATATACGACCCGTCAACCGCGTCCGAATACGCGGTTTCGATTAAACGAAAAAAACCATCTTTTAGTCGCGTATTTCGGTGACGGGTC...

Protein

Download Protein FASTA

489 aa · TkA03G011210|TK1151|PROTEIN

MLSISQKMFTKIQISKMATKSMKPKNKINIKKNMNRMIMLWAISYGGKSSHIHGGRVKYTTRQPRPNTRFRLNEKNHLLVAYFGDGSFSWCSPSQLKPFIENFQEMSNQSDSKKFVHAVRTALDTIGTLIESEFTRVARVADVANGGIKPGVAVPKGNTVRVLVNQMSPVEILLKVDSYATGFEVELGLELTVVKGWLGAFYYQKGGYTLPEYHDPKCIEGLEDKSGTGDINGPSECGDDKKRKQKSVAELLLEDEPKNK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G011210`
TK1151 ID	TkA03G011210
OH-1004 ID	LXL04_006140
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.800
Protein coverage (%)	TK1151 85.481 / OH-1004 62.202 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G011210

Location Chr03:2885478-2888226 (+)

Description Similar to ATM: Serine/threonine-protein kinase ATM

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g27860`	May influence gene expression by regulating the function of the PRC2 complex and modulating H3K27me3 level.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006140 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009908 flower development Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0035098 ESC/E(Z) complex Cellular Component

KEGG gene cross-reference

ath:AT3G09670

ath:AT3G27860

ath:AT5G02950

ath:AT5G27650

ath:AT5G40340

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.976

Rank 1 · TkA03G011210 · TK1151

Cytoplasm0.069

Rank 2 · TkA03G011210 · TK1151

Cell membrane0.024

Rank 3 · TkA03G011210 · TK1151

Endoplasmic reticulum0.018

Rank 4 · TkA03G011210 · TK1151

Plastid0.009

Rank 5 · TkA03G011210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00855PWWP73-124 aa

PF00855PWWP356-356 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G011210	`PF00855`	PWWP	73	124	2.3e-06	28.7
TkA03G011210	`PF00855`	PWWP	356	356	2.3e-06	28.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LK91`	Arabidopsis thaliana	sp\|Q9LK91\|PDP6_ARATH PWWP domain-containing protein 6	41.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card