TkA03G009290 | RubberDandelionOmics

Gene overview

TkA03G009290

Reference: TK1151 Chr: Chr03 Coordinates: 2305951-2309514 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1527 bp · TkA03G009290|TK1151|cDNA

AAAATATTAAAAAGAAACCCCAATGTTAATTGCTCCCCAAGCCTAAACCAAACTAAAAGCTCAAATCCCCTCCTACTAGTTACTAGTTAGGACATGTGAATGATAAAAAGCCAAGCAAAATCTCAGCCGTTGTTTCCGTCCAATTTTATCCAACTCCTTTCCCCCTACTCCGTCCGCCGTCGCTACCTATTCCGGCATGGCCGCCACACCGGAGAATGGTACAGTTGATATCTCTGCTGAAGCTGTGGTGGTCGACGACG...

CDS

Download CDS FASTA

1062 bp · TkA03G009290|TK1151|CDS

ATGGCCGCCACACCGGAGAATGGTACAGTTGATATCTCTGCTGAAGCTGTGGTGGTCGACGACGCCGTCAGTTTCGGATTTGAGCGGAAGGAGATGTACACCGAGAAACTCTCCGGATCCGTTCATCCTTACGAACGACACGTTTTCCTATGCTACAAGACTCACGAAGACTGGCCTGCTCGTGTTGAATCCTCCGACTCCGATCTGCTCCCTAAGCGACTTGCCGGAGCTATCAAGGAGCGTAAGAACGATATCGCTGT...

Protein

Download Protein FASTA

353 aa · TkA03G009290|TK1151|PROTEIN

MAATPENGTVDISAEAVVVDDAVSFGFERKEMYTEKLSGSVHPYERHVFLCYKTHEDWPARVESSDSDLLPKRLAGAIKERKNDIAVKTLLTICEGGDATGLSDGDVMIFPDMIKYSGLEESNIDTFVEEVLVNGKPWTSGPQEAVTVTGSYVFVCAHNSRDKRCGVCGPALIEKFNEEIEVRALKDEVLVSPCSHVGGHKYAGNLIIYSSVEDGKVSGHWYGYVTPGDVAELLDLHIKKGEIIERIWRGEMGVPPVEKA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G009290`
TK1151 ID	TkA03G009290
OH-1004 ID	LXL04_006101
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.150 / OH-1004 94.851 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G009290`
Location	Chr03:2305951-2309514 (-)
Description	Similar to AIM32: Altered inheritance of mitochondria protein 32 (Candida glabrata (strain ATCC 2001 / CBS 138 / JCM 3761 / NBRC 0622 / NRRL Y-65)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006101` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005758 mitochondrial intermembrane space Cellular Component GO:0005759 mitochondrial matrix Cellular Component
KEGG gene cross-reference	cgr:2890881 dha:DEHA2E10956g lth:KLTH0C02882g pgu:PGUG_03650 zro:ZYRO0G04708g These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.310

Rank 1 · TkA03G009290 · TK1151

Cytoplasm0.250

Rank 2 · TkA03G009290 · TK1151

Plastid0.243

Rank 3 · TkA03G009290 · TK1151

Nucleus0.158

Rank 4 · TkA03G009290 · TK1151

Endoplasmic reticulum0.112

Rank 5 · TkA03G009290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06999Suc_Fer-like37-250 aa

PF26444DUF8123135-148 aa

PF25304WHD_eIF2D303-331 aa

PF26444DUF8123328-348 aa

PF23987Phage_holin_10331-353 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G009290	`PF06999`	Suc_Fer-like	37	250	9.5e-46	157.0
TkA03G009290	`PF26444`	DUF8123	135	148	0.29	11.5
TkA03G009290	`PF25304`	WHD_eIF2D	303	331	0.26	12.3
TkA03G009290	`PF26444`	DUF8123	328	348	0.29	11.5
TkA03G009290	`PF23987`	Phage_holin_10	331	353	0.094	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card