TkA03G008400 | RubberDandelionOmics

Gene overview

TkA03G008400

Reference: TK1151 Chr: Chr03 Coordinates: 2061506-2064689 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2105 bp · TkA03G008400|TK1151|cDNA

ACGGATTTTAAAATTGAGTTAAAAAGAGAAAAACTTTGGACTTCGAGTGCCTTTTCCGATTTAATATTTGCATTTAACCAGATGAACGTTACTCAGATGATTGTTTCCTCCAAATTCAAACCAGTAGGACCCAACCTTAAGCTGAAAAAGAAGAAAAACCCAGTCCCCTTTCCTATAACGTACGCCACTTTCCATTCAAATTTCAAAATTTCGAGTAAATTGACAGTTTGCAGACATGGGAGAATCGACATGTCTCATGC...

CDS

Download CDS FASTA

1620 bp · TkA03G008400|TK1151|CDS

ATGGGAGAATCGACATGTCTCATGCCTCCTATATCTGAACCCAACAACCACGGGAATCATGTTCATGCTCTTGGAGATTCCGTCTCTTTTGGGAGGTTCACGTCGGAGTCGTTAGCTTGGGAGAAATGGTCAACGTTTTCTCATAAACGGTACGTTGAAGAAGCAAAGAGTTACGCACAACCTGGATCTGTTGCCGAAAAAAAAGCTTTCTTCGAAGCTCATTACAAAAAAATCGCAGCTCAAAAAGCTGCAGCTGCTGA...

Protein

Download Protein FASTA

539 aa · TkA03G008400|TK1151|PROTEIN

MGESTCLMPPISEPNNHGNHVHALGDSVSFGRFTSESLAWEKWSTFSHKRYVEEAKSYAQPGSVAEKKAFFEAHYKKIAAQKAAAAEAAAAAALLEQEKYAAAATTTSTSPNSDDLPQPPLSNIRKPQPPLLNTEKIVNEEQTQLASNLVELGSEKISFAVNSKKKDLSNKIKNLEDHVSVSEDSTTSQMDRPLLKSKLNTDQEVLQPKIRRKPATTTTHSFRSTIVNNNNKKQLKIPSSPSSKYVALMHPRKENVNITT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G008400`
TK1151 ID	TkA03G008400
OH-1004 ID	LXL04_006082
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G008400

Location Chr03:2061506-2064689 (-)

Description Similar to WDL7: Protein WVD2-like 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g70950`	Microtubule-associated protein (MAP) that regulates the orientation of interphase cortical microtubules.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006082 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0001578 microtubule bundle formation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0071369 cellular response to ethylene stimulus Biological Process

GO:0072657 protein localization to membrane Biological Process

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005874 microtubule Cellular Component

GO:0055028 cortical microtubule Cellular Component

GO:0008017 microtubule binding Molecular Function

KEGG gene cross-reference

ath:AT1G70950

ath:AT2G25480

ath:AT2G35880

ath:AT4G32330

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.653

Rank 1 · TkA03G008400 · TK1151

Nucleus0.340

Rank 2 · TkA03G008400 · TK1151

Cell membrane0.097

Rank 3 · TkA03G008400 · TK1151

Mitochondrion0.030

Rank 4 · TkA03G008400 · TK1151

Endoplasmic reticulum0.024

Rank 5 · TkA03G008400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06886TPX266-94 aa

PF28626GMI1_Ig_1226-317 aa

PF06886TPX2396-464 aa

PF28626GMI1_Ig_1416-430 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G008400	`PF06886`	TPX2	66	94	2.3e-16	60.2
TkA03G008400	`PF28626`	GMI1_Ig_1	226	317	0.99	9.7
TkA03G008400	`PF06886`	TPX2	396	464	2.3e-16	60.2
TkA03G008400	`PF28626`	GMI1_Ig_1	416	430	0.99	9.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q67Y69`	Arabidopsis thaliana	sp\|Q67Y69\|WDL7_ARATH Protein WVD2-like 7	58.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card