TkA03G007940 | RubberDandelionOmics

Gene overview

TkA03G007940

Reference: TK1151 Chr: Chr03 Coordinates: 1934644-1936022 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1180 bp · TkA03G007940|TK1151|cDNA

TTTACGGGTTCTTGAATCTTCACGTGACTTGTACAGCAAACCAAATCACAACCCCTAAAACCCTTCTTCTCCAACTTTCATTCTTCAGAAAAAATGGGTAGCAACCAAGCGGCAGTGTCCTTCTTGACCAATATAGCACGCGCCGCCCTGGGCCTTGGCGCCTCGGCCACCATCCTCAACTCCTCCCTCTACACCGTCGACGGTGGCCAGCGTGCTGTCCTCTTCGATCGTTTCCGTGGAGTCATTGACGATACTGTCGG...

CDS

Download CDS FASTA

843 bp · TkA03G007940|TK1151|CDS

ATGGGTAGCAACCAAGCGGCAGTGTCCTTCTTGACCAATATAGCACGCGCCGCCCTGGGCCTTGGCGCCTCGGCCACCATCCTCAACTCCTCCCTCTACACCGTCGACGGTGGCCAGCGTGCTGTCCTCTTCGATCGTTTCCGTGGAGTCATTGACGATACTGTCGGCGAAGGTACTCATTTTCTCGTTCCATGGCTCCAAAAACCCTACATCTTCGATATCCGTACGAAGCCCCATACTTTCTCTTCCATATCCGGTAC...

Protein

Download Protein FASTA

280 aa · TkA03G007940|TK1151|PROTEIN

MGSNQAAVSFLTNIARAALGLGASATILNSSLYTVDGGQRAVLFDRFRGVIDDTVGEGTHFLVPWLQKPYIFDIRTKPHTFSSISGTKDLQMVNLTLRVLSRPEVNKLPSIFKTLGLEYDEKVLPSIGNEVLKAVVAQFNADQLLTERPHVSALVRDSLIRRAKDFNIVLDDVAITHLSYGAEFSKAVEQKQVAQQEAERSKFVVAKAEQERRAAIIRAEGESESAKLISDATSAAGMGLIELRRIEASREISTTLARSN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G007940`
TK1151 ID	TkA03G007940
OH-1004 ID	LXL04_006065
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 72.857 / OH-1004 92.308 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G007940

Location Chr03:1934644-1936022 (+)

Description Similar to PHB3: Prohibitin-3, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g40770`	Prohibitin probably acts as a holdase/unfoldase for the stabilization of newly synthesized mitochondrial proteins (By similarity).	Mutational loss of the prohibitin AtPHB3 results in an extreme constitutive ethylene response phenotype coupled with partial loss of ethylene-inducible gene expression in Arabidopsis seedlings.2007 · DOI: 10.1093/jxb/erm086 Mitochondrial type-I prohibitins of Arabidopsis thaliana are required for supporting proficient meristem development.2007 · DOI: 10.1111/j.1365-313x.2007.03276.x The Arabidopsis Prohibitin Gene PHB3 Functions in Nitric Oxide-Mediated Responses and in Hydrogen Peroxide-Induced Nitric Oxide Accumulation.2010 · DOI: 10.1105/tpc.109.072066
`At3g27280`	Prohibitin probably acts as a holdase/unfoldase for the stabilization of newly synthesized mitochondrial proteins.	No verified direct reference in this release
`At5g14300`	Prohibitin probably acts as a holdase/unfoldase for the stabilization of newly synthesized mitochondrial proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006065 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000001 mitochondrion inheritance Biological Process

GO:0000423 mitophagy Biological Process

GO:0006457 protein folding Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0007007 inner mitochondrial membrane organization Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009697 salicylic acid biosynthetic process Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009733 response to auxin Biological Process

GO:0033615 mitochondrial proton-transporting ATP synthase complex assembly Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045861 negative regulation of proteolysis Biological Process

KEGG gene cross-reference

ath:AT3G27280

ath:AT5G40770

ddi:DDB_G0290123

spo:2542354

vda:VDAG_00218

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.791

Rank 1 · TkA03G007940 · TK1151

Cytoplasm0.121

Rank 2 · TkA03G007940 · TK1151

Plastid0.113

Rank 3 · TkA03G007940 · TK1151

Cell membrane0.096

Rank 4 · TkA03G007940 · TK1151

Nucleus0.095

Rank 5 · TkA03G007940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01145Band_734-211 aa

PF12127FloA110-246 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G007940	`PF01145`	Band_7	34	211	8.1e-29	101.5
TkA03G007940	`PF12127`	FloA	110	246	0.00026	21.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04331`	Arabidopsis thaliana	sp\|O04331\|PHB3_ARATH Prohibitin-3, mitochondrial	84.500%	Swiss-Prot	High
`Q9LK25`	Arabidopsis thaliana	sp\|Q9LK25\|PHB4_ARATH Prohibitin-4, mitochondrial	81.400%	Swiss-Prot	High
`Q9LY99`	Arabidopsis thaliana	sp\|Q9LY99\|PHB5_ARATH Prohibitin-5, mitochondrial	63.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card