TkA03G001880 | RubberDandelionOmics

Gene overview

TkA03G001880

Reference: TK1151 Chr: Chr03 Coordinates: 472789-474246 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1428 bp · TkA03G001880|TK1151|cDNA

ATGGCCATGGTTGTTGACGAGCTGCCGGAATTTGGTTTATCGGAATTTACCAGCAGCAGTGCTACTACCCCGGACGATGATCACTCTCGTAGTTGGAGTGACTGGTCTCCAGTGGTCGACTGGGATGCATTTTCCGTTCAGCCCCAAGAGAACTTTCATGACCTTTTCGAACCAGAAATGGACGAAGATACAGATAAGACAGTTTCTTACTCTGACGATGATCGGAATCTTGCCTCTCCTGGTTCATTGATGAGTACTGA...

CDS

Download CDS FASTA

1428 bp · TkA03G001880|TK1151|CDS

ATGGCCATGGTTGTTGACGAGCTGCCGGAATTTGGTTTATCGGAATTTACCAGCAGCAGTGCTACTACCCCGGACGATGATCACTCTCGTAGTTGGAGTGACTGGTCTCCAGTGGTCGACTGGGATGCATTTTCCGTTCAGCCCCAAGAGAACTTTCATGACCTTTTCGAACCAGAAATGGACGAAGATACAGATAAGACAGTTTCTTACTCTGACGATGATCGGAATCTTGCCTCTCCTGGTTCATTGATGAGTACTGA...

Protein

Download Protein FASTA

475 aa · TkA03G001880|TK1151|PROTEIN

MAMVVDELPEFGLSEFTSSSATTPDDDHSRSWSDWSPVVDWDAFSVQPQENFHDLFEPEMDEDTDKTVSYSDDDRNLASPGSLMSTEPMTDCRLVHLLMAAAEAMTRDNKGHDLAAVILVRLKDMVSTHEGTNMERLAAYFTHALRNLLESKGGGGGGGGGGLHYKQQHHHRADILAAFQLLQDMSPYVKFGHFTANQAIIESVTHERRVHIIDYDIMEGIQWASLMQALISRKDGPPTPHLRITALSLPGSGRRSISTV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G001880`
TK1151 ID	TkA03G001880
OH-1004 ID	LXL04_006024
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G001880

Location Chr03:472789-474246 (-)

Description Similar to NSP2: Protein NODULATION SIGNALING PATHWAY 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g08250`	Probable transcription factor involved in plant development.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0263300`	Transcription factor involved in the control of strigolactone biosynthesis in roots through the activation of the beta-carotene isomerase D27, which participates in a pathway leading to biosynthesis of strigolactones.	Strigolactone biosynthesis in Medicago truncatula and rice requires the symbiotic GRAS-type transcription factors NSP1 and NSP2.2011 · DOI: 10.1105/tpc.111.089771

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006024 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0009877 nodulation Biological Process

GO:0036377 arbuscular mycorrhizal association Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0031965 nuclear membrane Cellular Component

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT4G08250

mtr:11406790

osa:107276070

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.903

Rank 1 · TkA03G001880 · TK1151

Cytoplasm0.158

Rank 2 · TkA03G001880 · TK1151

Cell membrane0.039

Rank 3 · TkA03G001880 · TK1151

Endoplasmic reticulum0.030

Rank 4 · TkA03G001880 · TK1151

Plastid0.019

Rank 5 · TkA03G001880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03514GRAS94-468 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G001880	`PF03514`	GRAS	94	468	3.5e-102	342.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SUF5`	Arabidopsis thaliana	sp\|Q9SUF5\|SCL26_ARATH Scarecrow-like protein 26	58.900%	Swiss-Prot	High
`Q84Q92`	Oryza sativa subsp. japonica	sp\|Q84Q92\|NSP2_ORYSJ Protein NODULATION SIGNALING PATHWAY 2	51.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card