TkA02G615160 | RubberDandelionOmics

Gene overview

TkA02G615160

Reference: TK1151 Chr: Chr02 Coordinates: 158597589-158602802 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1923 bp · TkA02G615160|TK1151|cDNA

ATGAAATTTGGTTCGGAAGAATGCTTCGGAATCTGTTTCGGAATTTTAAGTCTCGCAGCGCTTTTACCGTCAACATCTACCCTTTTCTCAGCCCCTCGCCAAAACTACGCGTTCTTCGACGGCGCAGGCCAGCCAATCGTCGACAACGGAATCCAGTACACCAACGTGTTTGACGCAAACTACGACTATGGCTTACCGTTTCTACAACGGTCTTCTCCCCCGTCTAGCTTCCAACAACCACTCCGACCAGGTTGGCCAAC...

CDS

Download CDS FASTA

1299 bp · TkA02G615160|TK1151|CDS

ATGAAATTTGGTTCGGAAGAATGCTTCGGAATCTGTTTCGGAATTTTAAGTCTCGCAGCGCTTTTACCGTCAACATCTACCCTTTTCTCAGCCCCTCGCCAAAACTACGCGTTCTTCGACGGCGCAGGCCAGCCAATCGTCGACAACGGAATCCAGTACACCAACGTGTTTGACGCAAACTACGACTATGGCTTACCGTTTCTACAACGGTCTTCTCCCCCGTCTAGCTTCCAACAACCACTCCGACCAGGTTGGCCAAC...

Protein

Download Protein FASTA

432 aa · TkA02G615160|TK1151|PROTEIN

MKFGSEECFGICFGILSLAALLPSTSTLFSAPRQNYAFFDGAGQPIVDNGIQYTNVFDANYDYGLPFLQRSSPPSSFQQPLRPGWPTKLRHGHLRSRSKHLPGSGTKREGKIGGFKVTKIPLAGKGRSLIWGIVCLLKTTGDCLELTRVQSVAKIINYNALGQVIACPGGKNSGLPTRGPEFEPPRRRDVSPGFTHCCGVSWEAVGSIPAIGISKAGWWRSLLVGFARVFRCILLIRGDGKERIWEFFMKRSNKRRWIFK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G615160`
TK1151 ID	TkA02G615160
OH-1004 ID	LXL04_032947
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	88.100
Protein coverage (%)	TK1151 15.509 / OH-1004 28.151 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G615160

Location Chr02:158597589-158602802 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g00820`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At1g01110`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At4g10640`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At3g49380`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At3g49260`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	Calcium channels activated by hydrogen peroxide mediate abscisic acid signalling in guard cells.2000 · DOI: 10.1038/35021067 A defined range of guard cell calcium oscillation parameters encodes stomatal movements.2001 · DOI: 10.1038/35082575 CO(2) signaling in guard cells: calcium sensitivity response modulation, a Ca(2+)-independent phase, and CO(2) insensitivity of the gca2 mutant.2006 · DOI: 10.1073/pnas.0602225103 Combinatorial interactions of multiple cis-elements regulating the induction of the Arabidopsis XERO2 dehydrin gene by abscisic acid and cold.2008 · DOI: 10.1111/j.1365-313x.2007.03399.x Calcium elevation-dependent and attenuated resting calcium-dependent abscisic acid induction of stomatal closure and abscisic acid-induced enhancement of calcium sensitivities of S-type anion and inward-rectifying K channels in Arabidopsis guard cells.2009 · DOI: 10.1111/j.1365-313x.2009.03872.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032947 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.332

Rank 1 · TkA02G615160 · TK1151

Cytoplasm0.281

Rank 2 · TkA02G615160 · TK1151

Cell membrane0.228

Rank 3 · TkA02G615160 · TK1151

Endoplasmic reticulum0.136

Rank 4 · TkA02G615160 · TK1151

Mitochondrion0.099

Rank 5 · TkA02G615160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00612IQ296-314 aa

PF24609IQ_SCN5A_C298-318 aa

PF00612IQ319-337 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G615160	`PF00612`	IQ	296	314	1.5e-08	34.4
TkA02G615160	`PF24609`	IQ_SCN5A_C	298	318	0.0058	16.8
TkA02G615160	`PF00612`	IQ	319	337	1.5e-08	34.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JHN2`	Arabidopsis thaliana	sp\|F4JHN2\|IQD17_ARATH Protein IQ-DOMAIN 17	44.800%	Swiss-Prot	Low
`Q9MAM4`	Arabidopsis thaliana	sp\|Q9MAM4\|IQD18_ARATH Protein IQ-DOMAIN 18	61.800%	Swiss-Prot	Low
`Q7XA83`	Arabidopsis thaliana	sp\|Q7XA83\|IQD16_ARATH Protein IQ-DOMAIN 16	40.700%	Swiss-Prot	Low
`Q9SG11`	Arabidopsis thaliana	sp\|Q9SG11\|IQD15_ARATH Protein IQ-DOMAIN 15	39.900%	Swiss-Prot	Low
`Q9ASW3`	Arabidopsis thaliana	sp\|Q9ASW3\|IQD21_ARATH Protein IQ-DOMAIN 21	51.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card