TkA02G607800 | RubberDandelionOmics

Gene overview

TkA02G607800

Reference: TK1151 Chr: Chr02 Coordinates: 156788827-156789723 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

897 bp · TkA02G607800|TK1151|cDNA

ATGGCAGCATCCTACTCACAGTCGACGTCAGCATTGATCCTACTCCTCTCCACCATTGCTTTCTCTTTCTTCAAACCCTTAGAAGCTGCCGGCATAGCCACCTACTGGGGCCAACACACTGATGAAGGCACCCTAGCCGCCACCTGTGCCACCGGAAACTACCAGTTTGTAAACATCGCTTTCTTGAACACTTTTGGCAACGGCCAAGCACCAGCTTTGAACCTCGCCGGTCACTGTGACCCCTCTTCCACGTGTTCTAG...

CDS

Download CDS FASTA

897 bp · TkA02G607800|TK1151|CDS

ATGGCAGCATCCTACTCACAGTCGACGTCAGCATTGATCCTACTCCTCTCCACCATTGCTTTCTCTTTCTTCAAACCCTTAGAAGCTGCCGGCATAGCCACCTACTGGGGCCAACACACTGATGAAGGCACCCTAGCCGCCACCTGTGCCACCGGAAACTACCAGTTTGTAAACATCGCTTTCTTGAACACTTTTGGCAACGGCCAAGCACCAGCTTTGAACCTCGCCGGTCACTGTGACCCCTCTTCCACGTGTTCTAG...

Protein

Download Protein FASTA

298 aa · TkA02G607800|TK1151|PROTEIN

MAASYSQSTSALILLLSTIAFSFFKPLEAAGIATYWGQHTDEGTLAATCATGNYQFVNIAFLNTFGNGQAPALNLAGHCDPSSTCSSLSNDIRACQSQGVKVFLSLGGAIGSYSLSSTQDAQQVSDYLWNSFLGGQSSSRPLGDAVLDGIDFDIEMGSGQFWSDLAKALAAHNSQQKVYLSAAPQCPIPDAHLDTAIQTGLFDYVWVQFYNNGQCEYGANTDALLARWNQWTQVNSNQIFLGLPAAPAAAGSGYMPPDVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G607800`
TK1151 ID	TkA02G607800
OH-1004 ID	LXL04_026916
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	61.700
Protein coverage (%)	TK1151 90.604 / OH-1004 90.429 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G607800`
Location	Chr02:156788827-156789723 (-)
Description	Similar to CHIT3: Acidic endochitinase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_026916` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000272 polysaccharide catabolic process Biological Process GO:0002221 pattern recognition receptor signaling pathway Biological Process GO:0006032 chitin catabolic process Biological Process GO:0009409 response to cold Biological Process GO:0009611 response to wounding Biological Process GO:0009642 response to light intensity Biological Process GO:0009651 response to salt stress Biological Process GO:0042631 cellular response to water deprivation Biological Process GO:0050832 defense response to fungus Biological Process GO:0005576 extracellular region Cellular Component GO:0005773 vacuole Cellular Component GO:0003796 lysozyme activity Molecular Function
KEGG gene cross-reference	ath:AT5G24090 nta:107825584 var:108339599 vvi:100233088 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.879

Rank 1 · TkA02G607800 · TK1151

Cytoplasm0.054

Rank 2 · TkA02G607800 · TK1151

Lysosome / Vacuole0.030

Rank 3 · TkA02G607800 · TK1151

Endoplasmic reticulum0.025

Rank 4 · TkA02G607800 · TK1151

Cell membrane0.019

Rank 5 · TkA02G607800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22474Ago_Mid25-107 aa

PF00704Glyco_hydro_1833-245 aa

PF23916TIM-barrel_EndoS144-242 aa

PF00704Glyco_hydro_18273-285 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G607800	`PF22474`	Ago_Mid	25	107	0.071	13.9
TkA02G607800	`PF00704`	Glyco_hydro_18	33	245	6.1e-21	76.1
TkA02G607800	`PF23916`	TIM-barrel_EndoS	144	242	0.12	12.8
TkA02G607800	`PF00704`	Glyco_hydro_18	273	285	6.1e-21	76.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card