TkA02G605840 | RubberDandelionOmics

Gene overview

TkA02G605840

Reference: TK1151 Chr: Chr02 Coordinates: 156300912-156301683 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

675 bp · TkA02G605840|TK1151|cDNA

ATGAGGTGTAGTAGGTCTTCAGAGAAGACAAAGCTAATTCATAAGAAAGGGTTATGGTCGCCTGATGAAGATCAAAAGCTCAGAGATTACATCACAAACCATGGACATGGTCTGCAAAGAAACGGAAAGAGTTGCAGATTAAGATGGATTAATTATCTACGGCCAGGATTGAAAAGAGGAACCTTCACCTCACATGAAGAGGACATCGTTCTCTCTCTTCATGCCACTTTAGGCAATAAGTGGTCTCAGATGTCACAACA...

CDS

Download CDS FASTA

675 bp · TkA02G605840|TK1151|CDS

ATGAGGTGTAGTAGGTCTTCAGAGAAGACAAAGCTAATTCATAAGAAAGGGTTATGGTCGCCTGATGAAGATCAAAAGCTCAGAGATTACATCACAAACCATGGACATGGTCTGCAAAGAAACGGAAAGAGTTGCAGATTAAGATGGATTAATTATCTACGGCCAGGATTGAAAAGAGGAACCTTCACCTCACATGAAGAGGACATCGTTCTCTCTCTTCATGCCACTTTAGGCAATAAGTGGTCTCAGATGTCACAACA...

Protein

Download Protein FASTA

224 aa · TkA02G605840|TK1151|PROTEIN

MRCSRSSEKTKLIHKKGLWSPDEDQKLRDYITNHGHGLQRNGKSCRLRWINYLRPGLKRGTFTSHEEDIVLSLHATLGNKWSQMSQHLPGRTDNEIKNHWHSHLKKKVLNLTIAMKSQDIQTLSYRRTDSSLESSEADGCRNLPKVLFADWLSLEQFHNLDASGNDDMCRYTIGSQNTVTNSELLNEGSSYGFAESDFYDLISEDNISQNFNNSAVTLYSCDEL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G605840`
TK1151 ID	TkA02G605840
OH-1004 ID	LXL04_011885
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G605840

Location Chr02:156300912-156301683 (-)

Description Similar to LAF1: Transcription factor LAF1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g25560`	Transcription factor that promotes photomorphogenesis in the light by participating in the transmission of phytochrome A (phyA) signals to downstream responses.	LAF1, a MYB transcription activator for phytochrome A signaling.2001 · DOI: 10.1101/gad.915001 FAR-RED ELONGATED HYPOCOTYL1 and FHY1-LIKE associate with the Arabidopsis transcription factors LAF1 and HFR1 to transmit phytochrome A signals for inhibition of hypocotyl elongation.2009 · DOI: 10.1105/tpc.109.067215
`At5g26660`	Probable transcription factor.	No verified direct reference in this release
`At1g09540`	Transcription factor that coordinates a small network of downstream target genes required for several aspects of plant growth and development, such as xylem formation and xylem cell differentiation, and lateral root formation.	AtMYB61, an R2R3-MYB transcription factor controlling stomatal aperture in Arabidopsis thaliana.2005 · DOI: 10.1016/j.cub.2005.06.041 MUM ENHANCERS are important for seed coat mucilage production and mucilage secretory cell differentiation in Arabidopsis thaliana.2009 · DOI: 10.1093/jxb/erp102 AtMYB61, an R2R3-MYB transcription factor, functions as a pleiotropic regulator via a small gene network.2012 · DOI: 10.1111/j.1469-8137.2012.04201.x Interactions between the R2R3-MYB transcription factor, AtMYB61, and target DNA binding sites.2013 · DOI: 10.1371/journal.pone.0065132 AaMYB1 and its orthologue AtMYB61 affect terpene metabolism and trichome development in Artemisia annua and Arabidopsis thaliana.2017 · DOI: 10.1111/tpj.13509
`At5g65230`	Probable transcription factor.	No verified direct reference in this release
`At1g35515`	Transcription activator.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011885 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000902 cell morphogenesis Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0009639 response to red or far red light Biological Process

GO:0010018 far-red light signaling pathway Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

GO:0010089 xylem development Biological Process

GO:0010091 trichome branching Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0010214 seed coat development Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

KEGG gene cross-reference

ath:AT1G09540

ath:AT3G01140

ath:AT4G25560

ath:AT5G26660

ath:AT5G65230

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.920

Rank 1 · TkA02G605840 · TK1151

Cytoplasm0.208

Rank 2 · TkA02G605840 · TK1151

Mitochondrion0.023

Rank 3 · TkA02G605840 · TK1151

Cell membrane0.019

Rank 4 · TkA02G605840 · TK1151

Endoplasmic reticulum0.009

Rank 5 · TkA02G605840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249Myb_DNA-binding16-53 aa

PF15963Myb_DNA-bind_716-35 aa

PF13921Myb_DNA-bind_619-67 aa

PF00249Myb_DNA-binding59-104 aa

PF13921Myb_DNA-bind_662-108 aa

PF15963Myb_DNA-bind_776-118 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G605840	`PF00249`	Myb_DNA-binding	16	53	4.4e-24	85.1
TkA02G605840	`PF15963`	Myb_DNA-bind_7	16	35	0.02	15.4
TkA02G605840	`PF13921`	Myb_DNA-bind_6	19	67	1.7e-16	60.8
TkA02G605840	`PF00249`	Myb_DNA-binding	59	104	4.4e-24	85.1
TkA02G605840	`PF13921`	Myb_DNA-bind_6	62	108	1.7e-16	60.8
TkA02G605840	`PF15963`	Myb_DNA-bind_7	76	118	0.02	15.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M0K4`	Arabidopsis thaliana	sp\|Q9M0K4\|LAF1_ARATH Transcription factor LAF1	56.500%	Swiss-Prot	Medium
`Q8LPH6`	Arabidopsis thaliana	sp\|Q8LPH6\|MYB86_ARATH Transcription factor MYB86	64.400%	Swiss-Prot	Low
`Q8VZQ2`	Arabidopsis thaliana	sp\|Q8VZQ2\|MYB61_ARATH Transcription factor MYB61	63.500%	Swiss-Prot	Low
`Q9FJP2`	Arabidopsis thaliana	sp\|Q9FJP2\|MYB53_ARATH Transcription factor MYB53	58.500%	Swiss-Prot	Low
`Q9SDS8`	Arabidopsis thaliana	sp\|Q9SDS8\|MYB8_ARATH Transcription factor MYB8	51.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card