TkA02G603910 | RubberDandelionOmics

Gene overview

TkA02G603910

Reference: TK1151 Chr: Chr02 Coordinates: 155704026-155705332 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1060 bp · TkA02G603910|TK1151|cDNA

TTAAAGATCCCATTTCTTGATGTACAATCAGGCACAAACAATTTCGACAAAAATCTAATAATCGGATCGGGGGGATTTGGTATAGTCTACAAAGCCATTCTTCGCGACAACTTCACAGTTGCGGTCAAACGAGGCGTCCCCGGGTCCCGTCAAGGCCTCCCGGAATTCCAAACGGAAATTACGATTTTGTCCAAAATCCGCCACCGCCATCTCGTATCCCTAGTCGGATTCTGCGAAGAACAGTCAGAGATGATCCTTGT...

CDS

Download CDS FASTA

1020 bp · TkA02G603910|TK1151|CDS

TTAAAGATCCCATTTCTTGATGTACAATCAGGCACAAACAATTTCGACAAAAATCTAATAATCGGATCGGGGGGATTTGGTATAGTCTACAAAGCCATTCTTCGCGACAACTTCACAGTTGCGGTCAAACGAGGCGTCCCCGGGTCCCGTCAAGGCCTCCCGGAATTCCAAACGGAAATTACGATTTTGTCCAAAATCCGCCACCGCCATCTCGTATCCCTAGTCGGATTCTGCGAAGAACAGTCAGAGATGATCCTTGT...

Protein

Download Protein FASTA

339 aa · TkA02G603910|TK1151|PROTEIN

LKIPFLDVQSGTNNFDKNLIIGSGGFGIVYKAILRDNFTVAVKRGVPGSRQGLPEFQTEITILSKIRHRHLVSLVGFCEEQSEMILVYEYMENGPLKNHLYGSNLPPLPWKKRLEICIGAARGLHYLHTGSAQGIIHRDVKSTNILLDESYLAKVADFGLSRSGPCLSETHVSTGVKGSFGYLDPEYFRRQQLTDKSDVYSFGVVLFEVLCARPAVDPLLGREEVNLGEWAVQWQKKGSLKRIVDRWIVDEIKPASLKKY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G603910`
TK1151 ID	TkA02G603910
OH-1004 ID	LXL04_011917
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.500
Protein coverage (%)	TK1151 98.230 / OH-1004 38.101 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G603910

Location Chr02:155704026-155705332 (-)

Description Similar to At5g24010: Probable receptor-like protein kinase At5g24010

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24010`	Probable receptor-like protein kinase At5g24010.	No verified direct reference in this release
`At3g46290`	Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.	Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106
`At5g54380`	Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.	A receptor-like kinase mediates the response of Arabidopsis cells to the inhibition of cellulose synthesis.2007 · DOI: 10.1016/j.cub.2007.05.018 Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106
`At5g59700`	Probable receptor-like protein kinase At5g59700.	No verified direct reference in this release
`At4g39110`	Probable receptor-like protein kinase At4g39110.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011917 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009555 pollen development Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016324 apical plasma membrane Cellular Component

GO:0043680 filiform apparatus Cellular Component

KEGG gene cross-reference

ath:AT2G21480

ath:AT3G46290

ath:AT4G39110

ath:AT5G24010

ath:AT5G59700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.585

Rank 1 · TkA02G603910 · TK1151

Cytoplasm0.363

Rank 2 · TkA02G603910 · TK1151

Nucleus0.233

Rank 3 · TkA02G603910 · TK1151

Endoplasmic reticulum0.041

Rank 4 · TkA02G603910 · TK1151

Golgi apparatus0.038

Rank 5 · TkA02G603910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase18-217 aa

PF07714PK_Tyr_Ser-Thr20-211 aa

PF03109ABC121-51 aa

PF01636APH54-98 aa

PF03109ABC182-162 aa

PF01636APH130-166 aa

PF14531Kinase-like132-230 aa

PF01636APH184-234 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G603910	`PF00069`	Pkinase	18	217	1.9e-40	139.7
TkA02G603910	`PF07714`	PK_Tyr_Ser-Thr	20	211	5.4e-45	154.4
TkA02G603910	`PF03109`	ABC1	21	51	0.00022	21.2
TkA02G603910	`PF01636`	APH	54	98	0.017	15.6
TkA02G603910	`PF03109`	ABC1	82	162	0.00022	21.2
TkA02G603910	`PF01636`	APH	130	166	0.017	15.6
TkA02G603910	`PF14531`	Kinase-like	132	230	0.14	12.1
TkA02G603910	`PF01636`	APH	184	234	0.017	15.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLW0`	Arabidopsis thaliana	sp\|Q9FLW0\|Y5241_ARATH Probable receptor-like protein kinase At5g24010	72.400%	Swiss-Prot	High
`Q9LX66`	Arabidopsis thaliana	sp\|Q9LX66\|HERK_ARATH Receptor-like protein kinase HERK 1	63.800%	Swiss-Prot	High
`Q9LK35`	Arabidopsis thaliana	sp\|Q9LK35\|THE1_ARATH Receptor-like protein kinase THESEUS 1	63.800%	Swiss-Prot	High
`Q9FN92`	Arabidopsis thaliana	sp\|Q9FN92\|Y5597_ARATH Probable receptor-like protein kinase At5g59700	62.900%	Swiss-Prot	High
`Q9T020`	Arabidopsis thaliana	sp\|Q9T020\|Y4391_ARATH Probable receptor-like protein kinase At4g39110	64.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card