RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G594810
Reference: TK1151 Chr: Chr02 Coordinates: 153452931-153457667 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3302 bp · TkA02G594810|TK1151|cDNA

AAAAAACAGCAATAACTCGCATTGATTCCGTGTCTGTCACCTTCCCGCGACCAAACTCATCAATATATGTTTACTAGCTAGAAGAAAAAAACCCTCTATATATTACAGTACTTTTTTCTTTCACACAAATCCATTCCACAAAATCTATCTACTTCTTTCAAAATCATGTTATTTATCCTCCTTAGTTTACTTCCGTTTCTTTTTCTCGATCAAAAACAAGAAGCTAGCTTAGCGCTATTATGTGGTATTCTAATTTTCGT...

CDS

Download CDS FASTA

1359 bp · TkA02G594810|TK1151|CDS

ATGTTATTTATCCTCCTTAGTTTACTTCCGTTTCTTTTTCTCGATCAAAAACAAGAAGCTAGCTTAGCGCTATTATGTGGTATTCTAATTTTCGTTATTTATAAAGCTTATCTTTTATCATCGTCTCCATCAATCTACCTTGTAGATTACTCTTGCTTAAAGCCACCAAGCAATTGGAGAGTACCCTTTTCGTCTTTTCTCGAACACTCAAAGATCGTTCACTCTCTTGACCAAGAAAGCGTTGACTTTATGTCCAAAGT...

Protein

Download Protein FASTA

452 aa · TkA02G594810|TK1151|PROTEIN

MLFILLSLLPFLFLDQKQEASLALLCGILIFVIYKAYLLSSSPSIYLVDYSCLKPPSNWRVPFSSFLEHSKIVHSLDQESVDFMSKVLGSSGKSQNTCIPPPLHYIPPRSSHEDAINEAQMLLFPVFQDLMSKTKISPLDIDIIIVNCSAFCPSPSLSSIIINRYSMREDIKSFNISGMGCSASALAVDMAHNLLKVHKNSNAVILSTEILSNGWYAGKDKSMMVLNCIFRSGSAAVLISNKKSAKKNSKYRLLYTLRTQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G594810
TK1151 IDTkA02G594810
OH-1004 IDLXL04_011996
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 81.295
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G594810
LocationChr02:153452931-153457667 (+)
DescriptionSimilar to KCS5: 3-ketoacyl-CoA synthase 5
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g25450 Mediates mostly the synthesis of very-long-chain fatty acids (VLCFAs) from 26 to 30 carbons in length.
Specific and differential inhibition of very-long-chain fatty acid elongases from Arabidopsis thaliana by different herbicides.2004 · DOI: 10.1073/pnas.0404600101
At1g68530 Contributes to cuticular wax and suberin biosynthesis.
CUT1, an Arabidopsis gene required for cuticular wax biosynthesis and pollen fertility, encodes a very-long-chain fatty acid condensing enzyme.1999 · DOI: 10.1105/tpc.11.5.825
Alterations in CER6, a gene identical to CUT1, differentially affect long-chain lipid content on the surface of pollen and stems.2000 · DOI: 10.1105/tpc.12.10.2001
At1g19440 3-ketoacyl-CoA synthase 4. No verified direct reference in this release
At2g16280 Involved in the elongation of C22 to C24 fatty acids, which are precursors for the biosynthesis of cuticular waxes, aliphatic suberins, and membrane lipids, including sphingolipids and phospholipids.
Arabidopsis 3-ketoacyl-coenzyme a synthase9 is involved in the synthesis of tetracosanoic acids as precursors of cuticular waxes, suberins, sphingolipids, and phospholipids.2013 · DOI: 10.1104/pp.112.210450
At4g34510 Active on saturated acyl-CoAs up to C22.
Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases.2006 · DOI: 10.1016/j.bbrc.2006.05.162

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_011996 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000038 very long-chain fatty acid metabolic process Biological Process
GO:0006633 fatty acid biosynthetic process Biological Process
GO:0009409 response to cold Biological Process
GO:0009416 response to light stimulus Biological Process
GO:0009826 unidimensional cell growth Biological Process
GO:0010025 wax biosynthetic process Biological Process
GO:0030497 fatty acid elongation Biological Process
GO:0042761 very long-chain fatty acid biosynthetic process Biological Process
GO:0048868 pollen tube development Biological Process
GO:0070417 cellular response to cold Biological Process
GO:0160062 cutin-based cuticle development Biological Process
GO:0005737 cytoplasm Cellular Component
KEGG gene cross-reference
ath:AT1G01120
ath:AT1G19440
ath:AT1G25450
ath:AT1G68530
ath:AT2G16280
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.832
Rank 1 · TkA02G594810 · TK1151
Cytoplasm0.057
Rank 2 · TkA02G594810 · TK1151
Cell membrane0.051
Rank 3 · TkA02G594810 · TK1151
Mitochondrion0.044
Rank 4 · TkA02G594810 · TK1151
Nucleus0.044
Rank 5 · TkA02G594810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28043KwaA3-51 aa
PF08392FAE1_CUT1_RppA43-326 aa
PF00195Chal_sti_synt_N161-240 aa
PF15569Imm40177-212 aa
PF08545ACP_syn_III179-245 aa
PF28043KwaA231-251 aa
PF15569Imm40279-312 aa
PF08541ACP_syn_III_C343-424 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G594810PF28043KwaA3515.97.4
TkA02G594810PF08392FAE1_CUT1_RppA433262.5e-103346.1
TkA02G594810PF00195Chal_sti_synt_N1612400.1512.2
TkA02G594810PF15569Imm401772120.212.4
TkA02G594810PF08545ACP_syn_III1792450.001119.6
TkA02G594810PF28043KwaA2312515.97.4
TkA02G594810PF15569Imm402793120.212.4
TkA02G594810PF08541ACP_syn_III_C3434249.7e-0936.0
TkA02G594810PF02797Chal_sti_synt_C3504100.0001622.4
TkA02G594810PF00195Chal_sti_synt_N3503630.1512.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9C6L5Arabidopsis thalianasp|Q9C6L5|KCS5_ARATH 3-ketoacyl-CoA synthase 546.000%Swiss-ProtMedium
Q9XF43Arabidopsis thalianasp|Q9XF43|KCS6_ARATH 3-ketoacyl-CoA synthase 645.500%Swiss-ProtMedium
Q9LN49Arabidopsis thalianasp|Q9LN49|KCS4_ARATH 3-ketoacyl-CoA synthase 441.000%Swiss-ProtMedium
Q9SIX1Arabidopsis thalianasp|Q9SIX1|KCS9_ARATH 3-ketoacyl-CoA synthase 941.200%Swiss-ProtMedium
O65677Arabidopsis thalianasp|O65677|KCS17_ARATH 3-ketoacyl-CoA synthase 1742.000%Swiss-ProtMedium

JBrowse

View in Genome Browser