TkA02G593850 | RubberDandelionOmics

Gene overview

TkA02G593850

Reference: TK1151 Chr: Chr02 Coordinates: 153185115-153187160 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1329 bp · TkA02G593850|TK1151|cDNA

TTGATTATGAAAAATAGGTAACTTTTTCCCTTTCGAGTCTTATCGTATTTGACTATTTGTCTAACAAGTACGGAAGGGAAAATTGGTTACGTCGTCTACGCTTTCACAGAAGAAGATTAGACAACAGAGTTGCTTAGGGTTTTCGCGTCCTCTATGGCTGCCCAATCTCTCTCGGTAATTCCAGTTTCCCCTTCATCTTCCGGTTGCCGGAGTCGAATTCATGCAATTCGTCGTTTCTCCCGTCCAGGAGGATGAATTCC...

CDS

Download CDS FASTA

630 bp · TkA02G593850|TK1151|CDS

ATGAATTCCAGGGCCAGGATAAGTTCATTCATCGGACTACAGCTCTCTATTCCTCAATCGAATTCGAGGCAAAGGAATTTAGGCCGGTACTCATCTATCGTCGCAACGGTTTCGTCTACCCCTACAGCTCCGACACCAGAGAAGGCAACTCCTGGAAAAACCGCCAAATGGTCGTTTAGATTCATAAAGTCGGTTGCCATGGGTGAATTGGAAGCTAGAAAGTTGAAGTTCATGAACACAGGGACCGAAGCCCTCTTGAT...

Protein

Download Protein FASTA

209 aa · TkA02G593850|TK1151|PROTEIN

MNSRARISSFIGLQLSIPQSNSRQRNLGRYSSIVATVSSTPTAPTPEKATPGKTAKWSFRFIKSVAMGELEARKLKFMNTGTEALLMGILVEGTSLAAKLLRESGVTLFKVRDETVRLLGKSDMYIFSPEHPPLTEPAQRAIDWAINEKLKSGETGEVTTSHLLLGIWAQKESAAHRIMATLGFDDDKANHLAKSMDIEIILSYKKMGL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G593850`
TK1151 ID	TkA02G593850
OH-1004 ID	LXL04_012005
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 86.364 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G593850

Location Chr02:153185115-153187160 (+)

Description Similar to CLPT1: ATP-dependent Clp protease ATP-binding subunit CLPT1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g25370`	Accessory protein regulating the assembly of the plastidial Clp protease system.	Assembly of the chloroplast ATP-dependent Clp protease in Arabidopsis is regulated by the ClpT accessory proteins.2011 · DOI: 10.1105/tpc.110.082321 Structures, Functions, and Interactions of ClpT1 and ClpT2 in the Clp Protease System of Arabidopsis Chloroplasts.2015 · DOI: 10.1105/tpc.15.00106
`At4g12060`	Accessory protein regulating the assembly of the plastidial Clp protease system.	Assembly of the chloroplast ATP-dependent Clp protease in Arabidopsis is regulated by the ClpT accessory proteins.2011 · DOI: 10.1105/tpc.110.082321 Structures, Functions, and Interactions of ClpT1 and ClpT2 in the Clp Protease System of Arabidopsis Chloroplasts.2015 · DOI: 10.1105/tpc.15.00106

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0230100`	Molecular chaperone that may interact with a ClpP-like protease involved in degradation of denatured proteins in the chloroplast.	No verified direct reference in this release
`Os04g0397100`	Molecular chaperone that may interact with a ClpP-like protease involved in degradation of denatured proteins in the chloroplast.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012005 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0034605 cellular response to heat Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009532 plastid stroma Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0043424 protein histidine kinase binding Molecular Function

KEGG gene cross-reference

ath:AT4G12060

ath:AT4G25370

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.859

Rank 1 · TkA02G593850 · TK1151

Mitochondrion0.091

Rank 2 · TkA02G593850 · TK1151

Nucleus0.070

Rank 3 · TkA02G593850 · TK1151

Cytoplasm0.024

Rank 4 · TkA02G593850 · TK1151

Cell membrane0.012

Rank 5 · TkA02G593850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02861Clp_N70-179 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G593850	`PF02861`	Clp_N	70	179	3e-13	50.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93WL3`	Arabidopsis thaliana	sp\|Q93WL3\|CLPT1_ARATH ATP-dependent Clp protease ATP-binding subunit CLPT1, chloroplastic	66.900%	Swiss-Prot	High
`Q8GW78`	Arabidopsis thaliana	sp\|Q8GW78\|CLPT2_ARATH ATP-dependent Clp protease ATP-binding subunit CLPT2, chloroplastic	62.200%	Swiss-Prot	High
`Q2QVG9`	Oryza sativa subsp. japonica	sp\|Q2QVG9\|CLPC2_ORYSJ Chaperone protein ClpC2, chloroplastic	32.300%	Swiss-Prot	Medium
`Q7F9I1`	Oryza sativa subsp. japonica	sp\|Q7F9I1\|CLPC1_ORYSJ Chaperone protein ClpC1, chloroplastic	32.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card