TkA02G593460 | RubberDandelionOmics

Gene overview

TkA02G593460

Reference: TK1151 Chr: Chr02 Coordinates: 153092542-153093793 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

939 bp · TkA02G593460|TK1151|cDNA

ATGGCATCTCACTGCGAACGAGCTCGCCAAGGTCAAGGTTTTGGACTGCAAACAATCGTGTGTATCCCTTCCGCCGATGGGGTTATTGAATTAGGTTCAACGGAGTTGATATTTCAGAGTGCAGATGTGATGAAGAAAGTCACGGTTTCGTTTAATTTCAGCGGGGATTTGATGCAGATCAACACAATACAGCATGCCGGAGGAGATAATGATCCCTCCTCGATTTGGCTTACAGATCCGGTGGCTACATCTACGGTGAC...

CDS

Download CDS FASTA

939 bp · TkA02G593460|TK1151|CDS

ATGGCATCTCACTGCGAACGAGCTCGCCAAGGTCAAGGTTTTGGACTGCAAACAATCGTGTGTATCCCTTCCGCCGATGGGGTTATTGAATTAGGTTCAACGGAGTTGATATTTCAGAGTGCAGATGTGATGAAGAAAGTCACGGTTTCGTTTAATTTCAGCGGGGATTTGATGCAGATCAACACAATACAGCATGCCGGAGGAGATAATGATCCCTCCTCGATTTGGCTTACAGATCCGGTGGCTACATCTACGGTGAC...

Protein

Download Protein FASTA

312 aa · TkA02G593460|TK1151|PROTEIN

MASHCERARQGQGFGLQTIVCIPSADGVIELGSTELIFQSADVMKKVTVSFNFSGDLMQINTIQHAGGDNDPSSIWLTDPVATSTVTTDIAPTKDSVDVIGSQRTNIIPSITSHVPNPSSSSLPENSRYINNPNRDSLQNQGVFGSRDLNFSEFGSVDRATAGRSGNTLYPKPESGRILDFSESKRSSTNNAALFSGQSQFLGAGENNKNKKKKKNKKRSPGSCDSNEDGMLSFVSGVLPSSSMGKSDGGAFTGADPDHS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G593460`
TK1151 ID	TkA02G593460
OH-1004 ID	LXL04_026146
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	93.400
Protein coverage (%)	TK1151 86.859 / OH-1004 37.158 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G593460

Location Chr02:153092542-153093793 (-)

Description Similar to MYC2: Transcription factor MYC2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32640`	Transcriptional activator.	Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling.2003 · DOI: 10.1105/tpc.006130 JASMONATE-INSENSITIVE1 encodes a MYC transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis.2004 · DOI: 10.1105/tpc.022319 A basic helix-loop-helix transcription factor in Arabidopsis, MYC2, acts as a repressor of blue light-mediated photomorphogenic growth.2005 · DOI: 10.1105/tpc.105.032060 Characterization of JAZ-interacting bHLH transcription factors that regulate jasmonate responses in Arabidopsis.2011 · DOI: 10.1093/jxb/erq408 The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses.2011 · DOI: 10.1105/tpc.110.080788 The basic helix-loop-helix transcription factor MYC2 directly represses PLETHORA expression during jasmonate-mediated modulation of the root stem cell niche in Arabidopsis.2011 · DOI: 10.1105/tpc.111.089870 Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression.2012 · DOI: 10.1105/tpc.112.098749 Arabidopsis basic helix-loop-helix transcription factors MYC2, MYC3, and MYC4 regulate glucosinolate biosynthesis, insect performance, and feeding behavior.2013 · DOI: 10.1105/tpc.113.115139 Role of arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression.1997 · DOI: 10.1105/tpc.9.10.1859
`At4g17880`	Transcription factor involved in jasmonic acid (JA) gene regulation.	Characterization of JAZ-interacting bHLH transcription factors that regulate jasmonate responses in Arabidopsis.2011 · DOI: 10.1093/jxb/erq408 The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses.2011 · DOI: 10.1105/tpc.110.080788 Arabidopsis basic helix-loop-helix transcription factors MYC2, MYC3, and MYC4 regulate glucosinolate biosynthesis, insect performance, and feeding behavior.2013 · DOI: 10.1105/tpc.113.115139

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0575000`	Transcriptional activator involved in jasmonate (JA) signaling pathway during spikelet development.	Jasmonic acid regulates spikelet development in rice.2014 · DOI: 10.1038/ncomms4476

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026146 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006568 L-tryptophan metabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0009269 response to desiccation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0009759 indole glucosinolate biosynthetic process Biological Process

GO:0009963 positive regulation of flavonoid biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT1G32640

ath:AT4G17880

dosa:Os10g0575000

osa:4349484

sly:101261048

sly:544165

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.907

Rank 1 · TkA02G593460 · TK1151

Cytoplasm0.145

Rank 2 · TkA02G593460 · TK1151

Cell membrane0.058

Rank 3 · TkA02G593460 · TK1151

Endoplasmic reticulum0.036

Rank 4 · TkA02G593460 · TK1151

Plastid0.017

Rank 5 · TkA02G593460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14215bHLH-MYC_N3-51 aa

PF20639Rrn6_K-rich92-147 aa

PF20639Rrn6_K-rich190-217 aa

PF14215bHLH-MYC_N195-218 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G593460	`PF14215`	bHLH-MYC_N	3	51	6.2e-12	46.9
TkA02G593460	`PF20639`	Rrn6_K-rich	92	147	0.22	13.1
TkA02G593460	`PF20639`	Rrn6_K-rich	190	217	0.22	13.1
TkA02G593460	`PF14215`	bHLH-MYC_N	195	218	6.2e-12	46.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39204`	Arabidopsis thaliana	sp\|Q39204\|MYC2_ARATH Transcription factor MYC2	38.800%	Swiss-Prot	Medium
`O49687`	Arabidopsis thaliana	sp\|O49687\|MYC4_ARATH Transcription factor MYC4	45.100%	Swiss-Prot	Low
`Q336P5`	Oryza sativa subsp. japonica	sp\|Q336P5\|MYC2_ORYSJ Transcription factor MYC2	30.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card