TkA02G591920 | RubberDandelionOmics

Gene overview

TkA02G591920

Reference: TK1151 Chr: Chr02 Coordinates: 152718957-152719535 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

579 bp · TkA02G591920|TK1151|cDNA

ATGGCACCAAAAACACTCATAGCTCTCGCCCTCTTCTGCCTCGCCGGAACAACAGCCTTCGCCGCCGTCAAACCCACCACCAACTACATCAAATCCTCGTGCGCCACCGTCACCTACCCTGCTCTATGCGAACAGTCCCTCGCCCCCTTCGCCAAAACCATCCAAAGCAGCCCATCTCAGCTCGCCCGTACGGCGTTGGCGGTGAGCTTGAAGCGATCTCAGTCCGCTCAGGCGTACCTCAACAAGCTCAAGAGATTCAA...

CDS

Download CDS FASTA

579 bp · TkA02G591920|TK1151|CDS

ATGGCACCAAAAACACTCATAGCTCTCGCCCTCTTCTGCCTCGCCGGAACAACAGCCTTCGCCGCCGTCAAACCCACCACCAACTACATCAAATCCTCGTGCGCCACCGTCACCTACCCTGCTCTATGCGAACAGTCCCTCGCCCCCTTCGCCAAAACCATCCAAAGCAGCCCATCTCAGCTCGCCCGTACGGCGTTGGCGGTGAGCTTGAAGCGATCTCAGTCCGCTCAGGCGTACCTCAACAAGCTCAAGAGATTCAA...

Protein

Download Protein FASTA

192 aa · TkA02G591920|TK1151|PROTEIN

MAPKTLIALALFCLAGTTAFAAVKPTTNYIKSSCATVTYPALCEQSLAPFAKTIQSSPSQLARTALAVSLKRSQSAQAYLNKLKRFKGLKPREKSAIGDCLEEVSDSLDRVSKSIEELKHCDRVTGQDFIWHMSNVQTWVSSALTDENTCMDGFGGKVMEGRIKTSVRAQITSVAHVTSNALALVNSFAKKH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G591920`
TK1151 ID	TkA02G591920
OH-1004 ID	LXL04_012028
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G591920

Location Chr02:152718957-152719535 (-)

Description Similar to 21 kDa protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g25260`	Pectin methylesterase (PME) inhibitor that can target PME3 in a pH-dependent manner, mainly in slightly acidic conditions (pH 6.0 and 5.0) but not at pH 7.0.	Tuning of Pectin Methylesterification: PECTIN METHYLESTERASE INHIBITOR 7 MODULATES THE PROCESSIVE ACTIVITY OF CO-EXPRESSED PECTIN METHYLESTERASE 3 IN A pH-DEPENDENT MANNER.2015 · DOI: 10.1074/jbc.m115.639534 Structural and dynamical characterization of the pH-dependence of the pectin methylesterase-pectin methylesterase inhibitor complex.2017 · DOI: 10.1074/jbc.ra117.000197
`At3g47380`	Pectin methylesterase (PME) inhibitor involved in the maintenance of cell wall integrity in response to necrotrophic pathogens.	No verified direct reference in this release
`At1g62770`	Pectin methylesterase (PME) inhibitor that probably targets root-expressed PME and PME3 in a moderate pH-dependent manner, mainly in slightly acidic conditions (pH 6.3 and 5.0) and to some extent at pH 7.5.	Combined Experimental and Computational Approaches Reveal Distinct pH Dependence of Pectin Methylesterase Inhibitors.2017 · DOI: 10.1104/pp.16.01790
`At5g20740`	Pectin methylesterase (PME) inhibitor that can target PMEs (e.g. PME2 and PME3) in a pH-dependent manner, mainly in slightly acidic conditions (pH 6.3 and 5.0) but not at pH 7.5.	Biochemical characterization of Pectin Methylesterase Inhibitor 3 from Arabidopsis thaliana .2022 · DOI: 10.1016/j.tcsw.2022.100080

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012028 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009641 shade avoidance Biological Process

GO:0009827 plant-type cell wall modification Biological Process

GO:0071669 plant-type cell wall organization or biogenesis Biological Process

GO:1902183 regulation of shoot apical meristem development Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048046 apoplast Cellular Component

GO:0004857 enzyme inhibitor activity Molecular Function

GO:0046910 pectinesterase inhibitor activity Molecular Function

KEGG gene cross-reference

ath:AT1G62770

ath:AT3G47380

ath:AT4G25260

ath:AT5G20740

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.612

Rank 1 · TkA02G591920 · TK1151

Endoplasmic reticulum0.138

Rank 2 · TkA02G591920 · TK1151

Cell membrane0.091

Rank 3 · TkA02G591920 · TK1151

Cytoplasm0.086

Rank 4 · TkA02G591920 · TK1151

Lysosome / Vacuole0.061

Rank 5 · TkA02G591920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04043PMEI28-184 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G591920	`PF04043`	PMEI	28	184	2e-38	132.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SB37`	Arabidopsis thaliana	sp\|Q9SB37\|PMEI7_ARATH Pectinesterase inhibitor 7	52.100%	Swiss-Prot	High
`Q9STY5`	Arabidopsis thaliana	sp\|Q9STY5\|PMI11_ARATH Pectinesterase inhibitor 11	51.800%	Swiss-Prot	High
`Q9SI72`	Arabidopsis thaliana	sp\|Q9SI72\|PMEI9_ARATH Pectinesterase inhibitor 9	48.500%	Swiss-Prot	Medium
`Q84WE4`	Arabidopsis thaliana	sp\|Q84WE4\|PMEI3_ARATH Pectinesterase inhibitor 3	43.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card