TkA02G589000 | RubberDandelionOmics

Gene overview

TkA02G589000

Reference: TK1151 Chr: Chr02 Coordinates: 151996200-152000124 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2900 bp · TkA02G589000|TK1151|cDNA

AAAAAGATTAATTATGAATATTAAATTCCCTTATCGTTGTTGTTGAACAATAAAAACACTGCAGCATTGTTACTTCCACAAAAAATAATAGAACAAATCCAGTTTTGGGAGGTGCGATTACGGCAAGGTGTCTCTTTTAACTTAACACCAGAGTCGTATGAAGATTTTGGTTCTCTTTGACACCTAACTAACTGATTTCACGTTTGATTCATTCTTTCCACGAAATTAAAGCGATTCTAGAGAGAGAATATCACGTAATC...

CDS

Download CDS FASTA

2343 bp · TkA02G589000|TK1151|CDS

ATGGAGGACGAAGAAATGATTCAAGGTGTAGATAAATTATCAACGCCTTCATATTTAGTCGTCGCTTTAGCAGTCAACGGGAGTAGAAAAACCAAATATGTGGTTAGATGGGCATTGGATAAATTCGTTCCCGAGGGTATTCTTCTCTTCAAATTGCTTCTCGTTCGCCCTAAAATCACCCGAATCCCAACTCCCATGGGTGTTGTTCCTGCTTCACAAGTGCGCGATGATGTAGTAATTGCTTACAAGAAAGAAGTCGA...

Protein

Download Protein FASTA

780 aa · TkA02G589000|TK1151|PROTEIN

MEDEEMIQGVDKLSTPSYLVVALAVNGSRKTKYVVRWALDKFVPEGILLFKLLLVRPKITRIPTPMGVVPASQVRDDVVIAYKKEVEWQAYEKLLPFKKICAMKKVQVEIIQIESDDVVDAITQEILKSNIGKLVIGSSSSGMFSRGKCLSSRISESVPSFCTVYAISKGKLLSLRASDSDTIGSSRDDNSSDSSSVTNSSRTEWTDQGSASSSQFFSSSLPMQRFEALSSINRTLHQKTGSVDIPGENSDSFRANSNAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G589000`
TK1151 ID	TkA02G589000
OH-1004 ID	LXL04_012074
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.200
Protein coverage (%)	TK1151 100.000 / OH-1004 96.988 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G589000

Location Chr02:151996200-152000124 (+)

Description Similar to PUB35: U-box domain-containing protein 35

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61550`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At4g25160`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At5g61560`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At5g51270`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At2g19410`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012074 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G19410

ath:AT4G25160

ath:AT5G61550

ath:AT5G61560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.485

Rank 1 · TkA02G589000 · TK1151

Cytoplasm0.376

Rank 2 · TkA02G589000 · TK1151

Nucleus0.262

Rank 3 · TkA02G589000 · TK1151

Endoplasmic reticulum0.048

Rank 4 · TkA02G589000 · TK1151

Golgi apparatus0.047

Rank 5 · TkA02G589000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00582Usp21-146 aa

PF05262Borrelia_P83308-414 aa

PF00582Usp346-368 aa

PF01636APH348-366 aa

PF00069Pkinase361-361 aa

PF17438DUF5417386-433 aa

PF23191WHD_MCM3_C390-442 aa

PF00069Pkinase428-680 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G589000	`PF00582`	Usp	21	146	0.38	12.0
TkA02G589000	`PF05262`	Borrelia_P83	308	414	1.3	8.1
TkA02G589000	`PF00582`	Usp	346	368	0.38	12.0
TkA02G589000	`PF01636`	APH	348	366	0.038	14.5
TkA02G589000	`PF00069`	Pkinase	361	361	1.5e-35	123.6
TkA02G589000	`PF17438`	DUF5417	386	433	0.15	13.1
TkA02G589000	`PF23191`	WHD_MCM3_C	390	442	0.056	14.4
TkA02G589000	`PF00069`	Pkinase	428	680	1.5e-35	123.6
TkA02G589000	`PF07714`	PK_Tyr_Ser-Thr	431	684	1.2e-36	127.1
TkA02G589000	`PF03109`	ABC1	457	574	0.034	14.0
TkA02G589000	`PF23191`	WHD_MCM3_C	460	473	0.056	14.4
TkA02G589000	`PF01636`	APH	519	559	0.038	14.5
TkA02G589000	`PF04564`	U-box	711	779	8.7e-18	65.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FKG6`	Arabidopsis thaliana	sp\|Q9FKG6\|PUB52_ARATH U-box domain-containing protein 52	48.500%	Swiss-Prot	Medium
`Q9SW11`	Arabidopsis thaliana	sp\|Q9SW11\|PUB35_ARATH U-box domain-containing protein 35	52.800%	Swiss-Prot	High
`Q9FKG5`	Arabidopsis thaliana	sp\|Q9FKG5\|PUB51_ARATH U-box domain-containing protein 51	46.900%	Swiss-Prot	Medium
`Q9LU47`	Arabidopsis thaliana	sp\|Q9LU47\|PUB53_ARATH Putative U-box domain-containing protein 53	47.200%	Swiss-Prot	Medium
`Q8S8S7`	Arabidopsis thaliana	sp\|Q8S8S7\|PUB34_ARATH U-box domain-containing protein 34	34.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card